Incidental Mutation 'R7544:Kcnh4'
ID584104
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100757080 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 152 (H152Q)
Ref Sequence ENSEMBL: ENSMUSP00000102984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055083] [ENSMUST00000107360] [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect probably benign
Transcript: ENSMUST00000055083
SMART Domains Protein: ENSMUSP00000057578
Gene: ENSMUSG00000045471

DomainStartEndE-ValueType
Pfam:Orexin 1 129 2.2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107360
SMART Domains Protein: ENSMUSP00000102983
Gene: ENSMUSG00000045471

DomainStartEndE-ValueType
Pfam:Orexin 1 106 2.3e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107361
AA Change: H152Q

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: H152Q

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107363
AA Change: H152Q

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: H152Q

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Arhgef10 T C 8: 14,979,854 S919P probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Cyp4a14 T A 4: 115,491,086 D398V probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gm884 T C 11: 103,615,448 E1898G probably benign Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Slmap T A 14: 26,429,846 E522D probably damaging Het
Slmap C T 14: 26,429,848 E522K probably damaging Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Wfikkn2 T C 11: 94,237,912 T468A probably benign Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R0613:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
R7353:Kcnh4 UTSW 11 100757199 missense probably benign 0.18
R7355:Kcnh4 UTSW 11 100752443 missense possibly damaging 0.92
R7563:Kcnh4 UTSW 11 100741854 missense probably benign 0.00
R7664:Kcnh4 UTSW 11 100750322 missense probably damaging 1.00
R7972:Kcnh4 UTSW 11 100752452 missense probably damaging 0.98
R8146:Kcnh4 UTSW 11 100755279 missense probably damaging 1.00
R8166:Kcnh4 UTSW 11 100741886 missense probably benign
R8234:Kcnh4 UTSW 11 100752267 missense possibly damaging 0.83
R8295:Kcnh4 UTSW 11 100749697 missense probably benign 0.17
R8318:Kcnh4 UTSW 11 100752328 missense probably damaging 1.00
R8347:Kcnh4 UTSW 11 100757749 missense probably damaging 1.00
R8413:Kcnh4 UTSW 11 100749793 missense possibly damaging 0.60
R8464:Kcnh4 UTSW 11 100757184 missense probably damaging 1.00
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCAACCGGTGTAGGACAGTC -3'
(R):5'- GCCACTGAGAAACCTAGGAG -3'

Sequencing Primer
(F):5'- TAGGACAGTCCGGTTCTGC -3'
(R):5'- TGAACGGGGATGCTCATGC -3'
Posted On2019-10-17