Incidental Mutation 'R7544:Gm884'
ID584105
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Namepredicted gene 884
SynonymsLOC380730
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103534577-103621140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103615448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1898 (E1898G)
Ref Sequence ENSEMBL: ENSMUSP00000058511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
Predicted Effect probably benign
Transcript: ENSMUST00000059279
AA Change: E1898G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: E1898G

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Arhgef10 T C 8: 14,979,854 S919P probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Cyp4a14 T A 4: 115,491,086 D398V probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnh4 G T 11: 100,757,080 H152Q probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Slmap T A 14: 26,429,846 E522D probably damaging Het
Slmap C T 14: 26,429,848 E522K probably damaging Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Wfikkn2 T C 11: 94,237,912 T468A probably benign Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7028:Gm884 UTSW 11 103614537 missense probably benign 0.28
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GTTCCTGATCCAAATGCTGTAATG -3'
(R):5'- GGTGCTTCCAGTTCCAGTTG -3'

Sequencing Primer
(F):5'- GTAGTGAAGACTCAGCTTGACCTTC -3'
(R):5'- CCAGTTCCAGTTGAGGGTCAAG -3'
Posted On2019-10-17