Incidental Mutation 'R7544:Slmap'
ID584111
Institutional Source Beutler Lab
Gene Symbol Slmap
Ensembl Gene ENSMUSG00000021870
Gene Namesarcolemma associated protein
SynonymsD330001L02Rik, Slap
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7544 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26413168-26534931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26429846 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 522 (E522D)
Ref Sequence ENSEMBL: ENSMUSP00000117816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038522] [ENSMUST00000090359] [ENSMUST00000102956] [ENSMUST00000112330] [ENSMUST00000112331] [ENSMUST00000139075]
Predicted Effect probably damaging
Transcript: ENSMUST00000038522
AA Change: E501D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046956
Gene: ENSMUSG00000021870
AA Change: E501D

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090359
AA Change: E505D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087836
Gene: ENSMUSG00000021870
AA Change: E505D

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 490 572 N/A INTRINSIC
coiled coil region 599 799 N/A INTRINSIC
transmembrane domain 801 823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102956
AA Change: E501D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100021
Gene: ENSMUSG00000021870
AA Change: E501D

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 486 568 N/A INTRINSIC
coiled coil region 595 794 N/A INTRINSIC
transmembrane domain 796 818 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112330
AA Change: E467D

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107949
Gene: ENSMUSG00000021870
AA Change: E467D

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 383 N/A INTRINSIC
coiled coil region 452 534 N/A INTRINSIC
coiled coil region 561 761 N/A INTRINSIC
transmembrane domain 763 785 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112331
AA Change: E367D

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107950
Gene: ENSMUSG00000021870
AA Change: E367D

DomainStartEndE-ValueType
coiled coil region 46 78 N/A INTRINSIC
coiled coil region 109 260 N/A INTRINSIC
coiled coil region 352 434 N/A INTRINSIC
coiled coil region 461 661 N/A INTRINSIC
transmembrane domain 663 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139075
AA Change: E522D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117816
Gene: ENSMUSG00000021870
AA Change: E522D

DomainStartEndE-ValueType
FHA 27 85 1.05e-8 SMART
coiled coil region 167 199 N/A INTRINSIC
coiled coil region 230 390 N/A INTRINSIC
coiled coil region 507 589 N/A INTRINSIC
coiled coil region 616 816 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123072
Gene: ENSMUSG00000021870
AA Change: E112D

DomainStartEndE-ValueType
coiled coil region 1 52 N/A INTRINSIC
coiled coil region 97 179 N/A INTRINSIC
coiled coil region 206 405 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117276
Gene: ENSMUSG00000021870
AA Change: E153D

DomainStartEndE-ValueType
coiled coil region 1 59 N/A INTRINSIC
coiled coil region 138 220 N/A INTRINSIC
coiled coil region 247 447 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a conserved striatin-interacting phosphatase and kinase complex. Striatin family complexes participate in a variety of cellular processes including signaling, cell cycle control, cell migration, Golgi assembly, and apoptosis. The protein encoded by this gene is a coiled-coil, tail-anchored membrane protein with a single C-terminal transmembrane domain that is posttranslationally inserted into membranes. Mutations in this gene are associated with Brugada syndrome, a cardiac channelopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous inactivation in this locus affects T cell development. Mice homozygous for a transposon induced allele exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik G A 17: 28,905,324 R335W probably damaging Het
4933427D14Rik C T 11: 72,198,939 V40I probably damaging Het
Abcb11 T C 2: 69,265,486 K837E probably benign Het
Arhgef10 T C 8: 14,979,854 S919P probably benign Het
Atxn2 T C 5: 121,781,368 S530P probably damaging Het
Bicc1 T C 10: 70,956,374 E268G possibly damaging Het
Capn7 T G 14: 31,340,050 L40V probably damaging Het
Cd28 A T 1: 60,769,700 N191I probably damaging Het
Cfap69 G A 5: 5,595,936 T588M not run Het
Csmd1 T C 8: 16,092,296 E1531G probably damaging Het
Cyp4a14 T A 4: 115,491,086 D398V probably damaging Het
Dchs2 T C 3: 83,355,127 S2901P probably damaging Het
Ddx11 G A 17: 66,126,285 G37S probably damaging Het
Diaph1 A T 18: 37,893,269 probably null Het
Ech1 T C 7: 28,825,967 V49A probably benign Het
Elovl4 T C 9: 83,783,218 Y196C probably damaging Het
Ern2 G A 7: 122,173,199 L679F probably benign Het
Fbf1 A T 11: 116,165,833 M17K probably benign Het
Flvcr1 C A 1: 191,025,946 G50W probably damaging Het
Fryl A G 5: 73,081,039 S1455P probably benign Het
Fzd9 A G 5: 135,249,862 Y390H probably damaging Het
Gm10436 T A 12: 88,176,080 Y451F probably benign Het
Gm12800 T C 4: 101,911,402 S317P possibly damaging Het
Gm884 T C 11: 103,615,448 E1898G probably benign Het
Gnai3 C T 3: 108,118,386 V126M Het
Gpc5 T C 14: 115,428,173 F470L probably damaging Het
Grin1 T C 2: 25,305,074 N332S probably benign Het
Gtf3c5 T A 2: 28,579,542 I117F possibly damaging Het
Hydin A T 8: 110,589,525 S4350C probably benign Het
Kcnh4 G T 11: 100,757,080 H152Q probably benign Het
Kcnk12 A T 17: 87,746,065 S390T possibly damaging Het
Klra9 T G 6: 130,191,220 T28P probably benign Het
Lef1 T A 3: 131,194,765 I327N probably damaging Het
Lin54 A G 5: 100,485,270 V185A possibly damaging Het
Lrrc4b A T 7: 44,462,551 I616F probably damaging Het
Mad2l1bp A G 17: 46,152,844 Y85H possibly damaging Het
Mars T C 10: 127,311,610 E7G probably benign Het
Mpnd G A 17: 56,011,666 R225H probably benign Het
Muc4 T A 16: 32,736,198 M1K probably null Het
Nckap5 A G 1: 126,026,211 L868S possibly damaging Het
Ndst1 G A 18: 60,697,184 T618M probably damaging Het
Npas1 A T 7: 16,460,974 probably null Het
Nr2f2 A T 7: 70,354,751 V384D probably damaging Het
Olfr1208 T A 2: 88,897,361 I79F probably damaging Het
Olfr378 A G 11: 73,425,770 L71P probably damaging Het
Olfr516 A G 7: 108,845,321 S230P probably benign Het
Paip1 T A 13: 119,445,801 F188I probably damaging Het
Pcdha4 A T 18: 36,953,723 I320L probably benign Het
Peg10 TCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATC T 6: 4,756,427 probably null Het
Pgpep1 C T 8: 70,650,518 G110R unknown Het
Pidd1 T A 7: 141,440,339 H558L possibly damaging Het
Ppp1r1a C T 15: 103,531,349 probably null Het
Prkcg A G 7: 3,310,565 D96G probably benign Het
Prpf40b A G 15: 99,306,018 N154S probably benign Het
Psg17 A G 7: 18,819,972 Y118H probably benign Het
Ptpn12 A G 5: 21,009,511 I209T probably damaging Het
Reln T A 5: 21,976,278 K1835* probably null Het
Sf3b3 T C 8: 110,838,283 M298V probably benign Het
Slc5a3 T A 16: 92,077,794 N246K probably benign Het
Tcp10c T A 17: 13,360,998 L230Q probably damaging Het
Tdo2 A G 3: 81,971,635 probably null Het
Tet3 A T 6: 83,404,641 W182R probably damaging Het
Tmem151a T A 19: 5,071,867 M35L unknown Het
Tom1l2 TTGATGATG TTGATG 11: 60,280,214 probably benign Het
Trak2 A T 1: 58,921,068 probably null Het
Trappc11 T A 8: 47,522,414 E256D possibly damaging Het
Trim62 C T 4: 128,902,553 T281I probably benign Het
Trip13 T C 13: 73,932,902 E115G probably benign Het
Trp63 A G 16: 25,802,087 T10A probably benign Het
Urah A T 7: 140,835,652 H11L probably damaging Het
Usp39 G A 6: 72,342,908 T109I probably damaging Het
Wfikkn2 T C 11: 94,237,912 T468A probably benign Het
Zfhx4 T G 3: 5,412,815 S3497A probably damaging Het
Zfp85 C T 13: 67,749,065 R296H probably benign Het
Other mutations in Slmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Slmap APN 14 26463710 missense probably damaging 0.97
IGL02612:Slmap APN 14 26459466 splice site probably benign
IGL02630:Slmap APN 14 26422431 missense possibly damaging 0.93
IGL02798:Slmap APN 14 26470378 missense possibly damaging 0.88
PIT4382001:Slmap UTSW 14 26533431 missense probably damaging 1.00
R0433:Slmap UTSW 14 26453594 nonsense probably null
R0963:Slmap UTSW 14 26468520 missense probably damaging 1.00
R1721:Slmap UTSW 14 26460218 splice site probably benign
R1848:Slmap UTSW 14 26422574 missense probably benign
R2151:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2152:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2153:Slmap UTSW 14 26418247 missense probably damaging 1.00
R2154:Slmap UTSW 14 26418247 missense probably damaging 1.00
R3725:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3726:Slmap UTSW 14 26427242 missense probably damaging 0.99
R3935:Slmap UTSW 14 26459415 missense probably benign
R4118:Slmap UTSW 14 26482872 missense probably damaging 0.99
R4594:Slmap UTSW 14 26465617 missense probably damaging 1.00
R4731:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4732:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4733:Slmap UTSW 14 26468535 missense probably damaging 0.97
R4817:Slmap UTSW 14 26462352 missense probably damaging 0.97
R4847:Slmap UTSW 14 26426608 missense possibly damaging 0.90
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R4860:Slmap UTSW 14 26460209 missense probably benign 0.22
R5092:Slmap UTSW 14 26463589 missense probably damaging 1.00
R5211:Slmap UTSW 14 26482962 missense probably damaging 1.00
R5387:Slmap UTSW 14 26459933 missense probably benign 0.22
R5821:Slmap UTSW 14 26462280 missense probably damaging 1.00
R6404:Slmap UTSW 14 26422411 splice site probably null
R6856:Slmap UTSW 14 26430092 intron probably null
R6977:Slmap UTSW 14 26533419 missense probably damaging 1.00
R7108:Slmap UTSW 14 26422521 missense probably benign 0.04
R7320:Slmap UTSW 14 26460072 missense possibly damaging 0.53
R7470:Slmap UTSW 14 26427420 missense probably benign
R7520:Slmap UTSW 14 26427420 missense probably benign
R7540:Slmap UTSW 14 26460191 missense probably damaging 0.99
R7544:Slmap UTSW 14 26429848 missense probably damaging 0.99
Z1177:Slmap UTSW 14 26533450 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACACTGGTTGTTGGAGCATC -3'
(R):5'- GTGCTTACCCTAATTTGCTTCTAAG -3'

Sequencing Primer
(F):5'- CACTGGTTGTTGGAGCATCTAACATC -3'
(R):5'- AGAGTGCCAGACTTTAGTT -3'
Posted On2019-10-17