Incidental Mutation 'R7545:Adamtsl1'
ID584144
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85764855 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 54 (E54D)
Ref Sequence ENSEMBL: ENSMUSP00000148689 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000213098
AA Change: E54D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aasdh A T 5: 76,880,014 F849I probably damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fam135b T C 15: 71,450,510 K1269E possibly damaging Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nf1 T A 11: 79,409,524 D287E probably benign Het
Nfyc T C 4: 120,773,769 probably null Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Olfr961 C T 9: 39,647,107 P127L probably damaging Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4947:Adamtsl1 UTSW 4 85764800 missense possibly damaging 0.93
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
R7908:Adamtsl1 UTSW 4 86356439 missense probably benign 0.02
R7934:Adamtsl1 UTSW 4 86243725 missense probably damaging 1.00
R8056:Adamtsl1 UTSW 4 86342032 missense possibly damaging 0.76
R8109:Adamtsl1 UTSW 4 86248069 missense
R8143:Adamtsl1 UTSW 4 86342255 missense possibly damaging 0.71
R8205:Adamtsl1 UTSW 4 86199413 makesense probably null
R8215:Adamtsl1 UTSW 4 86343145 missense probably benign 0.45
R8250:Adamtsl1 UTSW 4 86342609 missense probably damaging 1.00
R8261:Adamtsl1 UTSW 4 86276883 missense probably damaging 0.99
R8417:Adamtsl1 UTSW 4 86156689 missense possibly damaging 0.81
R8494:Adamtsl1 UTSW 4 86321984 missense probably damaging 0.99
R8516:Adamtsl1 UTSW 4 86342543 missense probably damaging 1.00
R8525:Adamtsl1 UTSW 4 86277010 missense probably damaging 1.00
Z1176:Adamtsl1 UTSW 4 86342177 missense probably damaging 0.99
Z1176:Adamtsl1 UTSW 4 86342693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CGGCCTTGAAATGAATCCAAAAG -3'
(R):5'- TAAAACGTGCCAGATGCCGG -3'

Sequencing Primer
(F):5'- TCCAAAAGGTTTTACAACTAAGAGAC -3'
(R):5'- ACCCCCATGGAGTCTGTGTG -3'
Posted On2019-10-17