Incidental Mutation 'R7545:Nfyc'
ID584146
Institutional Source Beutler Lab
Gene Symbol Nfyc
Ensembl Gene ENSMUSG00000032897
Gene Namenuclear transcription factor-Y gamma
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location120757438-120831572 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 120773769 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043429] [ENSMUST00000097906] [ENSMUST00000118902] [ENSMUST00000120779] [ENSMUST00000134979] [ENSMUST00000136236]
Predicted Effect probably null
Transcript: ENSMUST00000043429
SMART Domains Protein: ENSMUSP00000047441
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097906
SMART Domains Protein: ENSMUSP00000095516
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
Pfam:Histone 9 107 7.2e-17 PFAM
Pfam:CBFD_NFYB_HMF 41 105 7.8e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118902
SMART Domains Protein: ENSMUSP00000112610
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120779
SMART Domains Protein: ENSMUSP00000112810
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134979
SMART Domains Protein: ENSMUSP00000114640
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:1N1J|B 23 58 8e-9 PDB
low complexity region 88 128 N/A INTRINSIC
low complexity region 132 163 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000136236
SMART Domains Protein: ENSMUSP00000117646
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:CBFD_NFYB_HMF 41 70 5.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aasdh A T 5: 76,880,014 F849I probably damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Adamtsl1 A T 4: 85,764,855 E54D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fam135b T C 15: 71,450,510 K1269E possibly damaging Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nf1 T A 11: 79,409,524 D287E probably benign Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Olfr961 C T 9: 39,647,107 P127L probably damaging Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Nfyc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Nfyc APN 4 120781547 intron probably benign
IGL01522:Nfyc APN 4 120781524 missense probably damaging 1.00
IGL01673:Nfyc APN 4 120779110 unclassified probably benign
IGL03197:Nfyc APN 4 120773761 missense probably damaging 1.00
PIT4378001:Nfyc UTSW 4 120790491 critical splice acceptor site probably null
R0638:Nfyc UTSW 4 120768884 missense probably benign 0.19
R0725:Nfyc UTSW 4 120768734 unclassified probably benign
R0842:Nfyc UTSW 4 120759377 missense probably benign 0.16
R1480:Nfyc UTSW 4 120768724 critical splice donor site probably null
R1535:Nfyc UTSW 4 120761724 missense probably damaging 0.99
R1940:Nfyc UTSW 4 120773664 splice site probably benign
R3753:Nfyc UTSW 4 120765330 unclassified probably benign
R5605:Nfyc UTSW 4 120790489 splice site probably benign
R6047:Nfyc UTSW 4 120779117 splice site probably null
Z1176:Nfyc UTSW 4 120790487 splice site probably benign
Z1177:Nfyc UTSW 4 120790466 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGAAATGCTTTGGGTGGG -3'
(R):5'- TTCGTTGATTTCTGTCCAGCAAG -3'

Sequencing Primer
(F):5'- AAATGCTTTGGGTGGGAGGGAG -3'
(R):5'- AAAAGTCATCTCCTTGGGCTG -3'
Posted On2019-10-17