Incidental Mutation 'R7545:Aasdh'
ID584149
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76880014 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 849 (F849I)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570] [ENSMUST00000149602]
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: F849I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: F849I

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: F849I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: F849I

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146570
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149602
AA Change: F52I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: F52I

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Adamtsl1 A T 4: 85,764,855 E54D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fam135b T C 15: 71,450,510 K1269E possibly damaging Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nf1 T A 11: 79,409,524 D287E probably benign Het
Nfyc T C 4: 120,773,769 probably null Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Olfr961 C T 9: 39,647,107 P127L probably damaging Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
R8884:Aasdh UTSW 5 76891794 missense possibly damaging 0.94
R9028:Aasdh UTSW 5 76876130 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGACCCAGTGTTATGCTTGG -3'
(R):5'- CTGAAATCTCAATCAGATGGTGAGC -3'

Sequencing Primer
(F):5'- GTTATGCTTGGGCTATCACTAAC -3'
(R):5'- CTCAATCAGATGGTGAGCATAAATAG -3'
Posted On2019-10-17