Incidental Mutation 'R7545:Olfr961'
ID584167
Institutional Source Beutler Lab
Gene Symbol Olfr961
Ensembl Gene ENSMUSG00000059106
Gene Nameolfactory receptor 961
SynonymsMOR224-5, GA_x6K02T2PVTD-33343617-33344561
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39645085-39649556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39647107 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 127 (P127L)
Ref Sequence ENSEMBL: ENSMUSP00000151840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076548] [ENSMUST00000219295]
Predicted Effect probably damaging
Transcript: ENSMUST00000076548
AA Change: P127L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075863
Gene: ENSMUSG00000059106
AA Change: P127L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.1e-50 PFAM
Pfam:7tm_1 39 286 4.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219295
AA Change: P127L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aasdh A T 5: 76,880,014 F849I probably damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Adamtsl1 A T 4: 85,764,855 E54D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fam135b T C 15: 71,450,510 K1269E possibly damaging Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nf1 T A 11: 79,409,524 D287E probably benign Het
Nfyc T C 4: 120,773,769 probably null Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Olfr961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr961 APN 9 39647340 missense probably benign 0.19
IGL01792:Olfr961 APN 9 39647659 missense probably benign 0.07
R0344:Olfr961 UTSW 9 39647350 missense probably damaging 1.00
R0503:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R0525:Olfr961 UTSW 9 39647471 missense probably damaging 1.00
R0531:Olfr961 UTSW 9 39646872 missense probably benign
R1188:Olfr961 UTSW 9 39647476 missense probably damaging 1.00
R1453:Olfr961 UTSW 9 39647163 missense probably benign 0.01
R2970:Olfr961 UTSW 9 39646899 missense probably damaging 1.00
R3883:Olfr961 UTSW 9 39647124 missense probably benign 0.07
R4423:Olfr961 UTSW 9 39647116 missense probably damaging 1.00
R5129:Olfr961 UTSW 9 39647494 missense probably benign 0.03
R6148:Olfr961 UTSW 9 39647259 missense probably damaging 1.00
R6738:Olfr961 UTSW 9 39646661 start gained probably benign
R6778:Olfr961 UTSW 9 39646747 missense probably damaging 1.00
R7194:Olfr961 UTSW 9 39647091 missense probably benign 0.15
RF008:Olfr961 UTSW 9 39647263 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAATGTATGCCTGTGCCCTG -3'
(R):5'- ACACTGCAGGCATGTCACAG -3'

Sequencing Primer
(F):5'- GGAAACCTCTCCATCTTTGACTTAGG -3'
(R):5'- GAAGTAATAACTCACCTCACTGGGG -3'
Posted On2019-10-17