Incidental Mutation 'R7545:Nf1'
ID584178
Institutional Source Beutler Lab
Gene Symbol Nf1
Ensembl Gene ENSMUSG00000020716
Gene Nameneurofibromin 1
SynonymsNf-1, neurofibromin
MMRRC Submission
Accession Numbers

Genbank: NM_010897; MGI: 97306

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7545 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location79339693-79581612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79409524 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 287 (D287E)
Ref Sequence ENSEMBL: ENSMUSP00000071289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000219057]
Predicted Effect probably benign
Transcript: ENSMUST00000071325
AA Change: D287E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716
AA Change: D287E

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
AA Change: D287E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716
AA Change: D287E

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219057
AA Change: D287E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos die by day 14.5 with enlarged head and chest, pale liver, microphthalmia, cardiac defects and delayed organ development. Heterozygotes have elevated astrocyte number, predisposition to multiple tumor types and learning/memory deficits. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(16)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik A G 18: 57,730,823 E233G probably damaging Het
1700028K03Rik T C 5: 107,548,174 Y159H probably damaging Het
A1cf A T 19: 31,934,790 N435I possibly damaging Het
Aasdh A T 5: 76,880,014 F849I probably damaging Het
Aatf A T 11: 84,470,676 M367K probably benign Het
Acnat1 A T 4: 49,449,142 L208* probably null Het
Adam26b C T 8: 43,521,713 G84D probably damaging Het
Adamtsl1 A T 4: 85,764,855 E54D probably damaging Het
Ang6 T G 14: 44,002,179 I31L probably benign Het
Asic4 A G 1: 75,472,416 N403S probably damaging Het
B020004J07Rik T A 4: 101,837,962 I51L probably benign Het
Bicd1 G A 6: 149,513,492 V568M probably benign Het
Cfap45 A T 1: 172,538,596 M339L probably benign Het
Cnga4 A G 7: 105,407,079 D399G probably damaging Het
Csnk1g3 C T 18: 53,895,825 R17W probably damaging Het
Dnah11 A G 12: 117,931,204 F3636S probably damaging Het
Dscaml1 A T 9: 45,685,383 T842S probably benign Het
Ets2 C A 16: 95,715,083 Q236K probably benign Het
Ext2 C A 2: 93,813,763 V58L probably benign Het
Fam135b T C 15: 71,450,510 K1269E possibly damaging Het
Fech A G 18: 64,464,114 L258P probably damaging Het
Gls A G 1: 52,191,152 S467P probably damaging Het
Gm19410 T A 8: 35,802,625 D1141E probably damaging Het
Gm45861 T G 8: 27,581,004 M1246R unknown Het
Gm6902 T A 7: 23,273,662 I147L probably benign Het
Itga7 G T 10: 128,933,906 probably benign Het
Itpripl1 A T 2: 127,141,661 C180* probably null Het
Klhl33 C A 14: 50,893,174 V28F probably damaging Het
Kmo A T 1: 175,653,628 D304V probably damaging Het
Mier2 T C 10: 79,541,194 N537S possibly damaging Het
Mroh9 A G 1: 163,074,708 I112T possibly damaging Het
Mterf1a T A 5: 3,890,995 E291V probably damaging Het
Muc5ac T A 7: 141,808,668 N1905K unknown Het
Myt1l G A 12: 29,827,088 R246Q unknown Het
Nav2 A G 7: 49,582,857 E1854G probably damaging Het
Nelfcd A G 2: 174,423,978 probably null Het
Nfyc T C 4: 120,773,769 probably null Het
Obscn A T 11: 59,038,899 D5163E probably damaging Het
Olfr945 T A 9: 39,258,688 probably null Het
Olfr961 C T 9: 39,647,107 P127L probably damaging Het
Plppr1 A T 4: 49,320,002 L209F possibly damaging Het
Pmm1 T C 15: 81,951,602 D226G probably damaging Het
Polr1b T A 2: 129,117,846 probably null Het
Ppp2r5a A G 1: 191,372,609 V80A probably benign Het
Psrc1 A G 3: 108,386,443 probably null Het
Ralbp1 T C 17: 65,867,598 T60A probably benign Het
Rasal2 A T 1: 157,192,769 S217T possibly damaging Het
Rnase12 A G 14: 51,056,938 F95L probably damaging Het
Rnf152 A T 1: 105,284,232 I200K probably damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,927 probably benign Het
Ryk C T 9: 102,888,473 T327I probably damaging Het
Sell A T 1: 164,065,334 T40S probably benign Het
Slc15a2 G A 16: 36,775,602 H153Y probably damaging Het
Slit3 A G 11: 35,700,312 D1317G possibly damaging Het
Slx4 G A 16: 3,999,300 T19M probably benign Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Specc1l T C 10: 75,245,087 S106P probably benign Het
Speer1 C A 5: 11,344,917 Q124K possibly damaging Het
Stc2 T C 11: 31,367,799 N74S probably damaging Het
Strn3 A T 12: 51,627,760 S498T probably damaging Het
Sva C T 6: 42,042,214 T106I probably benign Het
Tle3 T A 9: 61,394,702 L131Q possibly damaging Het
Tmem135 T A 7: 89,305,519 R97W probably damaging Het
Tmx4 A G 2: 134,609,505 L176S possibly damaging Het
Tomm20l C A 12: 71,117,397 probably null Het
Topors A T 4: 40,262,173 F370L possibly damaging Het
Ulk4 T C 9: 121,141,838 T1023A probably benign Het
Unc13a C T 8: 71,641,509 probably null Het
Urb2 T C 8: 124,029,752 S733P probably benign Het
Vwf A G 6: 125,614,097 D750G Het
Xylt1 G A 7: 117,593,585 D373N probably benign Het
Other mutations in Nf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Nf1 APN 11 79395905 missense probably damaging 0.99
IGL00801:Nf1 APN 11 79428700 splice site probably benign
IGL00823:Nf1 APN 11 79565517 missense probably damaging 1.00
IGL00945:Nf1 APN 11 79469803 missense probably damaging 0.99
IGL00960:Nf1 APN 11 79445121 missense probably damaging 1.00
IGL01118:Nf1 APN 11 79546986 missense probably damaging 0.99
IGL01604:Nf1 APN 11 79441709 splice site probably benign
IGL01637:Nf1 APN 11 79547120 missense probably damaging 1.00
IGL01659:Nf1 APN 11 79559449 missense probably benign
IGL01764:Nf1 APN 11 79384187 missense probably benign
IGL01772:Nf1 APN 11 79390249 missense probably damaging 1.00
IGL02047:Nf1 APN 11 79425535 missense probably benign 0.04
IGL02052:Nf1 APN 11 79412727 missense probably damaging 1.00
IGL02071:Nf1 APN 11 79444121 missense possibly damaging 0.96
IGL02312:Nf1 APN 11 79444648 missense possibly damaging 0.95
IGL02341:Nf1 APN 11 79564926 missense probably benign 0.33
IGL02390:Nf1 APN 11 79565935 missense possibly damaging 0.64
IGL02390:Nf1 APN 11 79411676 splice site probably benign
IGL02475:Nf1 APN 11 79535667 missense probably damaging 1.00
IGL02567:Nf1 APN 11 79547143 missense probably damaging 1.00
IGL02571:Nf1 APN 11 79428627 missense probably damaging 1.00
IGL02664:Nf1 APN 11 79444598 critical splice acceptor site probably null
IGL02664:Nf1 APN 11 79444599 critical splice acceptor site probably null
IGL02992:Nf1 APN 11 79434933 splice site probably benign
IGL03006:Nf1 APN 11 79545431 missense probably damaging 1.00
IGL03216:Nf1 APN 11 79564895 missense probably benign 0.17
Diesel UTSW 11 79556723 missense probably damaging 0.96
Franklin UTSW 11 79473320 splice site probably null
Gasoline UTSW 11 79556789 missense probably benign 0.17
jackson UTSW 11 79447572 missense probably damaging 1.00
Jefferson UTSW 11 79446864 missense probably damaging 1.00
Phyletic_dwarf UTSW 11 79454189 missense probably damaging 1.00
C9142:Nf1 UTSW 11 79556731 missense probably damaging 0.98
I2289:Nf1 UTSW 11 79547776 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0055:Nf1 UTSW 11 79471551 missense probably damaging 1.00
R0081:Nf1 UTSW 11 79453979 splice site probably benign
R0115:Nf1 UTSW 11 79468876 critical splice donor site probably null
R0144:Nf1 UTSW 11 79547127 missense probably damaging 1.00
R0196:Nf1 UTSW 11 79468769 missense possibly damaging 0.94
R0196:Nf1 UTSW 11 79578272 missense probably damaging 1.00
R0217:Nf1 UTSW 11 79428574 splice site probably benign
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0238:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0239:Nf1 UTSW 11 79418574 missense possibly damaging 0.89
R0255:Nf1 UTSW 11 79408699 splice site probably null
R0362:Nf1 UTSW 11 79536878 missense probably damaging 1.00
R0364:Nf1 UTSW 11 79441957 nonsense probably null
R0464:Nf1 UTSW 11 79556789 missense probably benign 0.17
R0511:Nf1 UTSW 11 79438769 missense probably benign 0.01
R0549:Nf1 UTSW 11 79468771 missense probably damaging 0.99
R0585:Nf1 UTSW 11 79568701 missense probably damaging 0.99
R0636:Nf1 UTSW 11 79535703 missense probably damaging 0.99
R0924:Nf1 UTSW 11 79453866 missense probably damaging 0.98
R0942:Nf1 UTSW 11 79438711 missense probably benign 0.00
R1022:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1024:Nf1 UTSW 11 79547033 missense probably damaging 1.00
R1350:Nf1 UTSW 11 79412687 missense probably damaging 1.00
R1365:Nf1 UTSW 11 79547885 splice site probably null
R1395:Nf1 UTSW 11 79535983 missense possibly damaging 0.49
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1467:Nf1 UTSW 11 79428626 missense possibly damaging 0.88
R1477:Nf1 UTSW 11 79395859 nonsense probably null
R1508:Nf1 UTSW 11 79440909 missense probably damaging 1.00
R1512:Nf1 UTSW 11 79390369 missense probably damaging 1.00
R1605:Nf1 UTSW 11 79440923 missense probably benign 0.01
R1680:Nf1 UTSW 11 79550998 nonsense probably null
R1704:Nf1 UTSW 11 79463301 splice site probably null
R1707:Nf1 UTSW 11 79535604 missense probably damaging 1.00
R1741:Nf1 UTSW 11 79443931 missense probably benign
R1761:Nf1 UTSW 11 79384265 missense probably damaging 1.00
R1800:Nf1 UTSW 11 79553968 missense possibly damaging 0.94
R1873:Nf1 UTSW 11 79547161 missense probably damaging 1.00
R1966:Nf1 UTSW 11 79411564 missense possibly damaging 0.72
R1967:Nf1 UTSW 11 79412745 missense probably damaging 0.96
R1970:Nf1 UTSW 11 79553961 missense probably benign 0.08
R2059:Nf1 UTSW 11 79556723 missense probably damaging 0.96
R2105:Nf1 UTSW 11 79469826 missense possibly damaging 0.50
R2151:Nf1 UTSW 11 79447570 missense possibly damaging 0.94
R2211:Nf1 UTSW 11 79444064 missense probably benign 0.39
R2497:Nf1 UTSW 11 79443884 missense probably damaging 1.00
R2899:Nf1 UTSW 11 79412758 missense possibly damaging 0.93
R3086:Nf1 UTSW 11 79546986 missense probably damaging 1.00
R3120:Nf1 UTSW 11 79564899 missense probably damaging 0.99
R3744:Nf1 UTSW 11 79548747 missense probably benign 0.23
R3801:Nf1 UTSW 11 79559521 missense probably null 0.98
R3804:Nf1 UTSW 11 79559521 missense probably null 0.98
R4212:Nf1 UTSW 11 79469798 missense probably damaging 1.00
R4298:Nf1 UTSW 11 79384244 missense probably damaging 1.00
R4578:Nf1 UTSW 11 79445759 missense probably damaging 1.00
R4579:Nf1 UTSW 11 79468757 missense probably damaging 1.00
R4587:Nf1 UTSW 11 79536037 critical splice donor site probably null
R4793:Nf1 UTSW 11 79447572 missense probably damaging 1.00
R4834:Nf1 UTSW 11 79546297 missense probably damaging 1.00
R4863:Nf1 UTSW 11 79409409 missense probably damaging 1.00
R4967:Nf1 UTSW 11 79565553 critical splice donor site probably null
R4971:Nf1 UTSW 11 79444643 missense probably damaging 1.00
R5034:Nf1 UTSW 11 79444150 missense probably damaging 0.98
R5036:Nf1 UTSW 11 79446864 missense probably damaging 1.00
R5207:Nf1 UTSW 11 79454189 missense probably damaging 1.00
R5348:Nf1 UTSW 11 79564899 missense probably damaging 1.00
R5356:Nf1 UTSW 11 79473456 missense possibly damaging 0.94
R5444:Nf1 UTSW 11 79443959 missense possibly damaging 0.94
R5533:Nf1 UTSW 11 79445789 missense probably damaging 0.99
R5918:Nf1 UTSW 11 79569222 intron probably benign
R5978:Nf1 UTSW 11 79540419 missense probably damaging 1.00
R6140:Nf1 UTSW 11 79473320 splice site probably null
R6195:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6216:Nf1 UTSW 11 79411607 missense possibly damaging 0.93
R6233:Nf1 UTSW 11 79565975 missense probably damaging 0.99
R6257:Nf1 UTSW 11 79549491 missense probably damaging 1.00
R6258:Nf1 UTSW 11 79565755 intron probably null
R6756:Nf1 UTSW 11 79444587 splice site probably null
R6878:Nf1 UTSW 11 79434882 missense probably damaging 1.00
R6959:Nf1 UTSW 11 79549468 missense probably damaging 0.98
R7007:Nf1 UTSW 11 79447023 intron probably null
R7066:Nf1 UTSW 11 79556720 missense probably damaging 1.00
R7099:Nf1 UTSW 11 79570330 missense probably benign 0.08
R7213:Nf1 UTSW 11 79469819 missense probably benign 0.23
R7326:Nf1 UTSW 11 79564943 missense probably benign
R7348:Nf1 UTSW 11 79536850 missense probably benign
R7380:Nf1 UTSW 11 79546276 missense probably damaging 1.00
R7407:Nf1 UTSW 11 79448143 missense probably damaging 1.00
R7412:Nf1 UTSW 11 79473414 missense probably damaging 1.00
R7567:Nf1 UTSW 11 79547226 missense probably damaging 0.99
R7574:Nf1 UTSW 11 79408769 missense probably null 0.99
R7616:Nf1 UTSW 11 79384266 missense probably damaging 0.97
R7713:Nf1 UTSW 11 79425606 missense probably benign
R7737:Nf1 UTSW 11 79545488 missense probably benign 0.33
R7869:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7905:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
R7952:Nf1 UTSW 11 79418588 missense probably damaging 1.00
R7988:Nf1 UTSW 11 79547112 missense possibly damaging 0.80
X0052:Nf1 UTSW 11 79559416 missense probably damaging 0.99
Z1177:Nf1 UTSW 11 79564925 missense not run
Predicted Primers PCR Primer
(F):5'- AGGATGTGTCACATTAGCTCTTC -3'
(R):5'- GAGAGGTCAGAGCCTTTCAGTC -3'

Sequencing Primer
(F):5'- ACACTTCTCTTAGACTGTGATAGTTG -3'
(R):5'- AGGTCAGAGCCTTTCAGTCATGAC -3'
Posted On2019-10-17