Incidental Mutation 'R7546:Itgav'
ID584199
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Nameintegrin alpha V
Synonymsalphav-integrin, CD51, 1110004F14Rik, 2610028E01Rik, vitronectin receptor alpha polypeptide (VNRA), D430040G12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7546 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location83724397-83806916 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 83776550 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 448 (G448*)
Ref Sequence ENSEMBL: ENSMUSP00000028499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
Predicted Effect probably null
Transcript: ENSMUST00000028499
AA Change: G448*
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: G448*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111740
AA Change: G412*
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: G412*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83802995 missense probably damaging 1.00
IGL01969:Itgav APN 2 83803283 missense probably damaging 1.00
IGL02371:Itgav APN 2 83770053 missense probably damaging 1.00
IGL02563:Itgav APN 2 83771236 missense probably benign
IGL02640:Itgav APN 2 83791939 missense probably benign 0.33
IGL02641:Itgav APN 2 83768345 splice site probably benign
IGL02927:Itgav APN 2 83795540 missense probably damaging 1.00
IGL03172:Itgav APN 2 83765846 missense possibly damaging 0.51
R0158:Itgav UTSW 2 83792037 missense probably benign 0.33
R0346:Itgav UTSW 2 83792609 missense probably damaging 1.00
R0508:Itgav UTSW 2 83792658 splice site probably benign
R0546:Itgav UTSW 2 83803242 missense probably benign 0.04
R0554:Itgav UTSW 2 83794270 missense possibly damaging 0.95
R1122:Itgav UTSW 2 83791939 missense probably benign 0.33
R1468:Itgav UTSW 2 83765901 splice site probably benign
R1566:Itgav UTSW 2 83736630 missense probably damaging 1.00
R1657:Itgav UTSW 2 83801779 missense probably benign 0.21
R1892:Itgav UTSW 2 83771336 missense probably damaging 1.00
R1912:Itgav UTSW 2 83795486 missense possibly damaging 0.85
R2176:Itgav UTSW 2 83803255 missense probably damaging 1.00
R2438:Itgav UTSW 2 83776542 missense probably damaging 1.00
R2449:Itgav UTSW 2 83768750 critical splice donor site probably null
R3110:Itgav UTSW 2 83792571 nonsense probably null
R3112:Itgav UTSW 2 83792571 nonsense probably null
R3176:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3177:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3276:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3277:Itgav UTSW 2 83776542 missense probably damaging 1.00
R3766:Itgav UTSW 2 83801885 critical splice donor site probably null
R3774:Itgav UTSW 2 83791964 missense probably damaging 1.00
R3880:Itgav UTSW 2 83768301 missense probably damaging 1.00
R4196:Itgav UTSW 2 83768327 missense probably benign 0.24
R4287:Itgav UTSW 2 83724840 nonsense probably null
R4620:Itgav UTSW 2 83755902 missense probably benign 0.07
R4790:Itgav UTSW 2 83755810 missense probably damaging 1.00
R4946:Itgav UTSW 2 83788983 missense probably benign 0.16
R6150:Itgav UTSW 2 83776436 missense probably benign
R6345:Itgav UTSW 2 83802036 missense probably damaging 1.00
R6482:Itgav UTSW 2 83794270 missense probably damaging 1.00
R6900:Itgav UTSW 2 83803247 missense probably damaging 1.00
R7247:Itgav UTSW 2 83724835 missense probably damaging 0.98
R7317:Itgav UTSW 2 83794983 missense probably benign 0.12
R7429:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7430:Itgav UTSW 2 83794258 missense probably damaging 1.00
R7522:Itgav UTSW 2 83802029 missense probably benign 0.10
R7578:Itgav UTSW 2 83747875 missense probably benign 0.16
R8311:Itgav UTSW 2 83765777 missense probably damaging 1.00
V1662:Itgav UTSW 2 83783854 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCAAGAATGTCTTCTGGCCATC -3'
(R):5'- AAACCTTGGAATGTGCATTTGG -3'

Sequencing Primer
(F):5'- GTCCACAGATATTGCAATTGCTG -3'
(R):5'- ACCTTGGAATGTGCATTTGGCTTTC -3'
Posted On2019-10-17