Incidental Mutation 'R7546:Nup160'
ID584202
Institutional Source Beutler Lab
Gene Symbol Nup160
Ensembl Gene ENSMUSG00000051329
Gene Namenucleoporin 160
SynonymsGtl1-13, 2810011M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7546 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90677215-90736328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90685058 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 170 (I170T)
Ref Sequence ENSEMBL: ENSMUSP00000059289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057481]
Predicted Effect probably damaging
Transcript: ENSMUST00000057481
AA Change: I170T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059289
Gene: ENSMUSG00000051329
AA Change: I170T

DomainStartEndE-ValueType
Pfam:Nup160 28 543 9.9e-134 PFAM
low complexity region 695 710 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1302 1315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUP160 is 1 of up to 60 proteins that make up the 120-MD nuclear pore complex, which mediates nucleoplasmic transport.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Nup160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Nup160 APN 2 90693106 missense probably damaging 1.00
IGL00938:Nup160 APN 2 90732827 missense probably damaging 1.00
IGL01111:Nup160 APN 2 90733209 missense probably benign 0.00
IGL01140:Nup160 APN 2 90700565 missense possibly damaging 0.85
IGL01348:Nup160 APN 2 90700428 missense probably benign 0.05
IGL01361:Nup160 APN 2 90684012 nonsense probably null
IGL01595:Nup160 APN 2 90729737 missense probably damaging 1.00
IGL01791:Nup160 APN 2 90703853 missense probably damaging 1.00
IGL02058:Nup160 APN 2 90729707 missense probably damaging 1.00
IGL02147:Nup160 APN 2 90703941 missense probably benign 0.17
IGL02250:Nup160 APN 2 90708870 missense probably damaging 1.00
IGL02507:Nup160 APN 2 90729735 missense probably benign 0.08
IGL03108:Nup160 APN 2 90703825 missense probably benign
R0031:Nup160 UTSW 2 90717587 splice site probably null
R0365:Nup160 UTSW 2 90708844 missense probably benign 0.01
R0417:Nup160 UTSW 2 90735427 missense possibly damaging 0.93
R0781:Nup160 UTSW 2 90733219 splice site probably benign
R1037:Nup160 UTSW 2 90693902 missense probably damaging 1.00
R1110:Nup160 UTSW 2 90733219 splice site probably benign
R1459:Nup160 UTSW 2 90690150 missense probably damaging 1.00
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1468:Nup160 UTSW 2 90700543 missense probably benign
R1478:Nup160 UTSW 2 90679399 start gained probably benign
R1565:Nup160 UTSW 2 90722061 missense possibly damaging 0.62
R1617:Nup160 UTSW 2 90679499 missense probably benign
R1647:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1648:Nup160 UTSW 2 90710088 missense probably damaging 0.99
R1702:Nup160 UTSW 2 90683958 missense probably damaging 0.96
R1719:Nup160 UTSW 2 90700436 nonsense probably null
R2448:Nup160 UTSW 2 90722057 missense probably damaging 1.00
R3775:Nup160 UTSW 2 90722076 missense probably benign
R3776:Nup160 UTSW 2 90722076 missense probably benign
R4600:Nup160 UTSW 2 90685197 critical splice donor site probably null
R4812:Nup160 UTSW 2 90725691 missense probably damaging 1.00
R5075:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R5309:Nup160 UTSW 2 90732832 nonsense probably null
R5312:Nup160 UTSW 2 90732832 nonsense probably null
R5447:Nup160 UTSW 2 90725615 missense possibly damaging 0.82
R5682:Nup160 UTSW 2 90679811 missense probably benign 0.29
R5726:Nup160 UTSW 2 90717851 missense probably damaging 1.00
R5771:Nup160 UTSW 2 90723396 missense probably damaging 1.00
R5825:Nup160 UTSW 2 90679770 critical splice acceptor site probably null
R5851:Nup160 UTSW 2 90707038 missense probably benign
R5988:Nup160 UTSW 2 90689209 missense probably damaging 1.00
R6151:Nup160 UTSW 2 90690105 nonsense probably null
R6164:Nup160 UTSW 2 90717876 nonsense probably null
R6356:Nup160 UTSW 2 90711935 splice site probably null
R6379:Nup160 UTSW 2 90702409 nonsense probably null
R6519:Nup160 UTSW 2 90718217 missense probably damaging 0.99
R6755:Nup160 UTSW 2 90700456 missense probably damaging 1.00
R6989:Nup160 UTSW 2 90707020 missense probably benign 0.34
R7251:Nup160 UTSW 2 90700174 missense probably damaging 0.99
R7256:Nup160 UTSW 2 90723355 missense probably damaging 1.00
R7353:Nup160 UTSW 2 90703952 missense probably damaging 0.99
R7761:Nup160 UTSW 2 90703112 missense probably benign
R7768:Nup160 UTSW 2 90700116 missense probably damaging 1.00
R7959:Nup160 UTSW 2 90713895 critical splice donor site probably null
R8525:Nup160 UTSW 2 90718096 critical splice donor site probably null
R8726:Nup160 UTSW 2 90733201 missense possibly damaging 0.86
R8745:Nup160 UTSW 2 90700119 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGGAAGCTTTTGTCTTGTCCTC -3'
(R):5'- CGTTGATGGCTGAGTCATGCTC -3'

Sequencing Primer
(F):5'- ACAGGTGCTTATAGCCACTG -3'
(R):5'- CAGTTCCCATACTTACCAGGTACG -3'
Posted On2019-10-17