Incidental Mutation 'R7546:Cadps2'
ID584215
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene NameCa2+-dependent activator protein for secretion 2
SynonymsCaps2, cpd2, A230044C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7546 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location23262773-23839421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23626608 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 227 (M227K)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: M227K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: M227K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115356
AA Change: M227K

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: M227K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: M227K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: M198K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: M198K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: M227K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: M198K

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: M198K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAAAGCAGCTATTCCCAG -3'
(R):5'- TGTGGCCAGAATGGTTCAAAG -3'

Sequencing Primer
(F):5'- GCAGCTATTCCCAGGGTCATAC -3'
(R):5'- TCAAAGTGGAGGATGCTCTGC -3'
Posted On2019-10-17