Incidental Mutation 'R7546:Cadps2'
ID 584215
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, A230044C21Rik, cpd2
MMRRC Submission 045617-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7546 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 23262772-23839420 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23626607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 227 (M227K)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: M227K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: M227K

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115356
AA Change: M227K

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: M227K

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: M227K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: M198K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: M198K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: M227K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: M227K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: M198K

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: M198K

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.1533 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,348,330 (GRCm39) S36P probably benign Het
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Ampd1 A G 3: 103,003,028 (GRCm39) T582A probably benign Het
Ank1 A C 8: 23,555,011 (GRCm39) N57T probably damaging Het
Atxn3 A G 12: 101,914,261 (GRCm39) probably null Het
Bace2 G A 16: 97,200,882 (GRCm39) A117T probably benign Het
Bcl2l15 A G 3: 103,740,203 (GRCm39) N19S probably benign Het
Bid C A 6: 120,877,112 (GRCm39) probably null Het
Clip4 G A 17: 72,135,697 (GRCm39) C483Y possibly damaging Het
Dennd4a A G 9: 64,780,326 (GRCm39) T621A probably damaging Het
E2f3 G A 13: 30,094,112 (GRCm39) S383L probably damaging Het
F2r C T 13: 95,754,858 (GRCm39) V9I probably benign Het
Gm14226 T C 2: 154,867,131 (GRCm39) S363P probably damaging Het
Gstm5 T C 3: 107,804,610 (GRCm39) Y65H probably damaging Het
H2bc13 A G 13: 21,900,040 (GRCm39) S92P probably benign Het
H60c A G 10: 3,209,907 (GRCm39) W127R probably damaging Het
Itgav G T 2: 83,606,894 (GRCm39) G448* probably null Het
Klrh1 T C 6: 129,749,343 (GRCm39) H84R probably benign Het
Lhx6 C T 2: 35,993,357 (GRCm39) probably null Het
Manba T A 3: 135,276,007 (GRCm39) V816D probably benign Het
Marchf10 G A 11: 105,280,906 (GRCm39) P460S not run Het
Mmp17 T A 5: 129,673,653 (GRCm39) V244E probably damaging Het
Mtrr C T 13: 68,730,268 (GRCm39) probably benign Het
Nup160 T C 2: 90,515,402 (GRCm39) I170T probably damaging Het
Or4c12b A G 2: 89,647,363 (GRCm39) N225S probably benign Het
Or4c12b A T 2: 89,647,538 (GRCm39) L283F probably damaging Het
Or51e1 T C 7: 102,358,996 (GRCm39) S177P probably damaging Het
Pappa G A 4: 65,074,352 (GRCm39) S302N possibly damaging Het
Plekhj1 G A 10: 80,633,748 (GRCm39) A53V possibly damaging Het
Pramel46 T A 5: 95,418,171 (GRCm39) H275L possibly damaging Het
Pramel48 C T 5: 95,630,539 (GRCm39) R139C probably benign Het
Prpf8 T C 11: 75,399,200 (GRCm39) V2157A probably damaging Het
Rps8 G A 4: 117,011,104 (GRCm39) R200W probably damaging Het
Sesn2 A G 4: 132,227,154 (GRCm39) F93L probably damaging Het
Skic3 C A 13: 76,282,954 (GRCm39) L759M probably damaging Het
Slf1 A G 13: 77,197,311 (GRCm39) S768P probably benign Het
Stat4 A G 1: 52,137,622 (GRCm39) N471S probably damaging Het
Trcg1 T C 9: 57,155,621 (GRCm39) L758P probably benign Het
Trim35 A G 14: 66,540,696 (GRCm39) T183A probably benign Het
Ttr C A 18: 20,803,102 (GRCm39) Y89* probably null Het
Zfp90 C A 8: 107,151,323 (GRCm39) H345Q probably benign Het
Zmym4 A G 4: 126,757,961 (GRCm39) V1531A probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23,496,873 (GRCm39) missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23,321,699 (GRCm39) splice site probably benign
IGL01317:Cadps2 APN 6 23,314,172 (GRCm39) missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23,587,440 (GRCm39) missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23,263,672 (GRCm39) missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23,587,461 (GRCm39) missense probably benign 0.19
IGL01674:Cadps2 APN 6 23,355,851 (GRCm39) missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23,382,904 (GRCm39) missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23,427,274 (GRCm39) missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23,427,309 (GRCm39) missense probably benign 0.01
IGL02200:Cadps2 APN 6 23,385,527 (GRCm39) missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23,287,731 (GRCm39) missense probably benign 0.11
IGL02680:Cadps2 APN 6 23,838,895 (GRCm39) missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23,321,706 (GRCm39) missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23,496,808 (GRCm39) missense probably benign 0.08
IGL03061:Cadps2 APN 6 23,287,659 (GRCm39) splice site probably null
IGL03233:Cadps2 APN 6 23,263,600 (GRCm39) missense probably benign 0.10
R0193:Cadps2 UTSW 6 23,599,439 (GRCm39) missense probably benign 0.00
R0389:Cadps2 UTSW 6 23,321,781 (GRCm39) missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23,583,411 (GRCm39) missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23,321,703 (GRCm39) critical splice donor site probably null
R0620:Cadps2 UTSW 6 23,583,395 (GRCm39) missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23,287,697 (GRCm39) missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23,321,739 (GRCm39) missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23,328,775 (GRCm39) splice site probably benign
R0942:Cadps2 UTSW 6 23,263,561 (GRCm39) missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23,838,793 (GRCm39) missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23,583,472 (GRCm39) splice site probably benign
R1575:Cadps2 UTSW 6 23,429,217 (GRCm39) missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23,320,931 (GRCm39) critical splice donor site probably null
R1924:Cadps2 UTSW 6 23,688,857 (GRCm39) missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23,599,479 (GRCm39) missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23,287,685 (GRCm39) missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23,323,379 (GRCm39) missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23,839,121 (GRCm39) missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2147:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2148:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2150:Cadps2 UTSW 6 23,838,998 (GRCm39) intron probably benign
R2219:Cadps2 UTSW 6 23,410,831 (GRCm39) missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23,323,339 (GRCm39) missense probably benign 0.15
R2338:Cadps2 UTSW 6 23,838,977 (GRCm39) splice site probably benign
R3861:Cadps2 UTSW 6 23,355,860 (GRCm39) missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23,528,125 (GRCm39) missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23,263,530 (GRCm39) utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23,599,462 (GRCm39) missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23,412,987 (GRCm39) missense probably benign 0.18
R4432:Cadps2 UTSW 6 23,626,737 (GRCm39) missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23,587,578 (GRCm39) missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23,688,859 (GRCm39) missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23,599,478 (GRCm39) missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23,287,742 (GRCm39) missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23,626,667 (GRCm39) missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23,329,103 (GRCm39) missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23,328,804 (GRCm39) missense probably benign 0.28
R6074:Cadps2 UTSW 6 23,626,670 (GRCm39) missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23,329,162 (GRCm39) critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23,263,577 (GRCm39) missense probably benign 0.04
R6463:Cadps2 UTSW 6 23,323,333 (GRCm39) nonsense probably null
R6907:Cadps2 UTSW 6 23,599,505 (GRCm39) missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23,302,491 (GRCm39) missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23,583,458 (GRCm39) missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23,323,408 (GRCm39) missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23,410,888 (GRCm39) missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23,688,955 (GRCm39) missense probably benign 0.02
R7184:Cadps2 UTSW 6 23,583,428 (GRCm39) missense probably benign 0.18
R7325:Cadps2 UTSW 6 23,409,934 (GRCm39) missense unknown
R7526:Cadps2 UTSW 6 23,496,850 (GRCm39) missense probably damaging 1.00
R7772:Cadps2 UTSW 6 23,390,445 (GRCm39) missense probably benign 0.00
R7870:Cadps2 UTSW 6 23,263,641 (GRCm39) missense probably benign 0.14
R8040:Cadps2 UTSW 6 23,412,942 (GRCm39) splice site probably benign
R8048:Cadps2 UTSW 6 23,838,862 (GRCm39) missense probably benign 0.14
R8082:Cadps2 UTSW 6 23,323,313 (GRCm39) missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23,838,808 (GRCm39) missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23,328,897 (GRCm39) missense probably benign 0.00
R8497:Cadps2 UTSW 6 23,355,918 (GRCm39) missense probably benign 0.27
R8768:Cadps2 UTSW 6 23,382,938 (GRCm39) missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23,302,303 (GRCm39) missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23,496,805 (GRCm39) missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23,587,536 (GRCm39) missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23,344,256 (GRCm39) missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23,385,507 (GRCm39) missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23,410,876 (GRCm39) missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23,344,223 (GRCm39) missense probably benign 0.11
R8921:Cadps2 UTSW 6 23,302,300 (GRCm39) missense probably benign 0.00
R9228:Cadps2 UTSW 6 23,688,927 (GRCm39) missense probably benign 0.00
R9297:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9318:Cadps2 UTSW 6 23,496,887 (GRCm39) missense probably benign
R9348:Cadps2 UTSW 6 23,344,262 (GRCm39) missense probably benign 0.20
R9447:Cadps2 UTSW 6 23,323,297 (GRCm39) missense probably damaging 0.96
R9484:Cadps2 UTSW 6 23,626,646 (GRCm39) missense probably benign 0.02
R9492:Cadps2 UTSW 6 23,427,238 (GRCm39) missense probably benign
R9630:Cadps2 UTSW 6 23,587,571 (GRCm39) missense probably benign 0.08
R9729:Cadps2 UTSW 6 23,382,982 (GRCm39) missense probably benign 0.28
Z1176:Cadps2 UTSW 6 23,321,800 (GRCm39) missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23,838,817 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,626,694 (GRCm39) missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23,385,477 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGCAAAGCAGCTATTCCCAG -3'
(R):5'- TGTGGCCAGAATGGTTCAAAG -3'

Sequencing Primer
(F):5'- GCAGCTATTCCCAGGGTCATAC -3'
(R):5'- TCAAAGTGGAGGATGCTCTGC -3'
Posted On 2019-10-17