Incidental Mutation 'R7546:Olfr558'
ID584217
Institutional Source Beutler Lab
Gene Symbol Olfr558
Ensembl Gene ENSMUSG00000070423
Gene Nameolfactory receptor 558
SynonymsMOR18-1, GA_x6K02T2PBJ9-5425951-5426904
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7546 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102702215-102712064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102709789 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 177 (S177P)
Ref Sequence ENSEMBL: ENSMUSP00000091674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably benign
Transcript: ENSMUST00000084817
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094124
AA Change: S177P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423
AA Change: S177P

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216312
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Olfr558
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr558 APN 7 102709565 missense probably damaging 0.99
IGL01925:Olfr558 APN 7 102710203 missense probably damaging 0.98
IGL02172:Olfr558 APN 7 102709844 missense probably benign
R0197:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R0883:Olfr558 UTSW 7 102709995 missense probably damaging 1.00
R1870:Olfr558 UTSW 7 102709754 missense possibly damaging 0.92
R2894:Olfr558 UTSW 7 102709675 missense probably damaging 0.99
R4033:Olfr558 UTSW 7 102709490 missense probably damaging 1.00
R4695:Olfr558 UTSW 7 102709557 missense probably damaging 1.00
R4738:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4739:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4740:Olfr558 UTSW 7 102710171 missense probably damaging 1.00
R4901:Olfr558 UTSW 7 102710198 missense probably benign 0.00
R5187:Olfr558 UTSW 7 102709661 missense probably damaging 1.00
R5385:Olfr558 UTSW 7 102709346 missense probably damaging 1.00
R5529:Olfr558 UTSW 7 102709693 nonsense probably null
R6666:Olfr558 UTSW 7 102709928 splice site probably null
R7318:Olfr558 UTSW 7 102710019 nonsense probably null
R7453:Olfr558 UTSW 7 102709517 missense probably damaging 0.99
R7643:Olfr558 UTSW 7 102709538 missense probably benign 0.00
R8387:Olfr558 UTSW 7 102710195 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTTGTCTGGCATGGAGTC -3'
(R):5'- AGTGCCAAACGCTTTTGCC -3'

Sequencing Primer
(F):5'- TCTGGCATGGAGTCCACAGTG -3'
(R):5'- AAACGCTTTTGCCTGGGC -3'
Posted On2019-10-17