Incidental Mutation 'R7546:Trcg1'
ID584220
Institutional Source Beutler Lab
Gene Symbol Trcg1
Ensembl Gene ENSMUSG00000070298
Gene Nametaste receptor cell gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7546 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57236556-57249864 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57248338 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 758 (L758P)
Ref Sequence ENSEMBL: ENSMUSP00000091357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000093837]
Predicted Effect probably benign
Transcript: ENSMUST00000034846
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093837
AA Change: L758P

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091357
Gene: ENSMUSG00000070298
AA Change: L758P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
Blast:SEA 449 549 5e-21 BLAST
low complexity region 580 594 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Trcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Trcg1 APN 9 57242273 missense probably benign
IGL01727:Trcg1 APN 9 57242594 missense probably damaging 0.97
IGL02147:Trcg1 APN 9 57245849 missense probably benign 0.20
IGL02329:Trcg1 APN 9 57240393 missense possibly damaging 0.92
IGL02658:Trcg1 APN 9 57242228 nonsense probably null
IGL02852:Trcg1 APN 9 57241312 missense possibly damaging 0.94
IGL03163:Trcg1 APN 9 57248347 missense possibly damaging 0.92
FR4589:Trcg1 UTSW 9 57242202 frame shift probably null
R0555:Trcg1 UTSW 9 57242333 missense probably damaging 1.00
R0747:Trcg1 UTSW 9 57241921 missense probably benign 0.00
R1061:Trcg1 UTSW 9 57245873 missense possibly damaging 0.66
R1521:Trcg1 UTSW 9 57242465 missense probably benign 0.36
R1622:Trcg1 UTSW 9 57248672 missense possibly damaging 0.94
R1652:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R4677:Trcg1 UTSW 9 57245861 missense possibly damaging 0.94
R4879:Trcg1 UTSW 9 57246720 missense probably damaging 0.99
R5013:Trcg1 UTSW 9 57242279 missense probably damaging 0.99
R5141:Trcg1 UTSW 9 57241304 missense probably damaging 1.00
R5690:Trcg1 UTSW 9 57241811 missense probably benign 0.36
R6416:Trcg1 UTSW 9 57241330 missense possibly damaging 0.46
R6980:Trcg1 UTSW 9 57245573 missense probably damaging 0.99
R7022:Trcg1 UTSW 9 57241569 missense possibly damaging 0.46
R7172:Trcg1 UTSW 9 57248335 missense probably benign 0.01
R7276:Trcg1 UTSW 9 57242579 missense probably damaging 0.99
R7412:Trcg1 UTSW 9 57241483 missense probably benign 0.00
R7942:Trcg1 UTSW 9 57242216 missense probably benign
R8087:Trcg1 UTSW 9 57248674 missense probably damaging 0.99
R8094:Trcg1 UTSW 9 57242281 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAACTTTGGTCAAGTGGTGG -3'
(R):5'- ACTTGGAGCCAATGTACCCTG -3'

Sequencing Primer
(F):5'- AATTCCAGTGAGTGTTCGGTTCAC -3'
(R):5'- CCTGGGGGCTCATAGGGAAG -3'
Posted On2019-10-17