Incidental Mutation 'R7546:Ttr'
ID 584236
Institutional Source Beutler Lab
Gene Symbol Ttr
Ensembl Gene ENSMUSG00000061808
Gene Name transthyretin
Synonyms prealbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7546 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20665250-20674324 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 20670045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 89 (Y89*)
Ref Sequence ENSEMBL: ENSMUSP00000074783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075312]
AlphaFold P07309
Predicted Effect probably null
Transcript: ENSMUST00000075312
AA Change: Y89*
SMART Domains Protein: ENSMUSP00000074783
Gene: ENSMUSG00000061808
AA Change: Y89*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TR_THY 27 147 5.95e-91 SMART
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a carrier protein responsible for the transport of thyroid hormones and retinol. The protein consists of a tetramer of identical subunits. Due to increased stability of the tetramer form of this encoded protein in mouse, compared to the human protein, this gene product has a reduced tendency to form amyloid fibrils. In humans, this protein binds beta-amyloid preventing its aggregation and providing a neuroprotective role in Alzheimer's disease. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene results in decreased circulating thyroxine, triiodothyronine, and retinol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik A G 17: 48,037,521 S36P probably benign Het
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in Ttr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02074:Ttr APN 18 20666523 missense probably benign 0.00
Quid_pro_quo UTSW 18 20673635 missense possibly damaging 0.73
transactional UTSW 18 20670045 nonsense probably null
R0709:Ttr UTSW 18 20669977 critical splice acceptor site probably null
R5133:Ttr UTSW 18 20670110 missense possibly damaging 0.46
R5979:Ttr UTSW 18 20670002 missense probably damaging 1.00
R6239:Ttr UTSW 18 20673635 missense possibly damaging 0.73
R8833:Ttr UTSW 18 20666493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGTACATAAAGTTCCCTCG -3'
(R):5'- CTCTGTGTTGCCAAGAATTGTC -3'

Sequencing Primer
(F):5'- ACATAAAGTTCCCTCGAATTTCTTGC -3'
(R):5'- AACAGGTTCAGGCCATGTTGC -3'
Posted On 2019-10-17