Mutagenetix > Incidental Mutation

Incidental Mutation 'R7547:Dnah7b'

584237

Institutional Source

Beutler Lab

Gene Symbol

Dnah7b

Ensembl Gene

ENSMUSG00000041144

Gene Name

dynein, axonemal, heavy chain 7B

Synonyms

LOC227058, Dnahc7b

MMRRC Submission

045618-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R7547 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46105475-46412710 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46253573 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1826 (I1826K)

Ref Sequence

ENSEMBL: ENSMUSP00000068738 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069293]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069293
AA Change: I1826K

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000068738
Gene: ENSMUSG00000041144
AA Change: I1826K

Domain	Start	End	E-Value	Type
coiled coil region	760	790	N/A	INTRINSIC
Pfam:DHC_N2	800	1209	3.7e-150	PFAM
AAA	1364	1503	3.24e-1	SMART
AAA	2012	2160	5.39e-2	SMART
Pfam:AAA_8	2347	2618	2.4e-75	PFAM
Pfam:MT	2630	2979	2.6e-54	PFAM
Pfam:AAA_9	3001	3226	2.3e-98	PFAM
Pfam:Dynein_heavy	3362	4064	8.4e-288	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	T	4: 53,109,269 (GRCm39)	D146E	probably benign	Het
Adgrl1	C	T	8: 84,665,513 (GRCm39)	A1400V	probably benign	Het
Ank2	A	G	3: 126,738,852 (GRCm39)	V2344A	unknown	Het
Anxa2r2	A	T	13: 120,488,457 (GRCm39)	F31I	probably damaging	Het
Aplnr	A	T	2: 84,967,521 (GRCm39)	D182V	probably damaging	Het
Asb4	C	T	6: 5,398,350 (GRCm39)	P105L	probably damaging	Het
Ate1	C	A	7: 130,106,539 (GRCm39)	R274I	probably benign	Het
Ccdc43	A	G	11: 102,582,948 (GRCm39)	V92A	probably benign	Het
Cfap69	T	A	5: 5,654,290 (GRCm39)	N548I	possibly damaging	Het
Clpb	A	G	7: 101,313,503 (GRCm39)		probably null	Het
Ctnnal1	G	A	4: 56,817,032 (GRCm39)	R597C	probably damaging	Het
Dchs2	A	G	3: 83,263,434 (GRCm39)	K3234R	probably damaging	Het
Dnah7a	T	A	1: 53,702,996 (GRCm39)	K151N	probably benign	Het
Dnttip1	A	G	2: 164,609,799 (GRCm39)	K289E	probably benign	Het
Eppk1	G	T	15: 75,991,740 (GRCm39)	Q1714K	probably benign	Het
Exoc4	A	G	6: 33,816,056 (GRCm39)	D674G	possibly damaging	Het
Galnt7	A	T	8: 58,036,996 (GRCm39)	V131D	possibly damaging	Het
Glg1	C	T	8: 111,914,393 (GRCm39)	V464M	possibly damaging	Het
Hlcs	G	T	16: 94,032,031 (GRCm39)	S444*	probably null	Het
Larp1	G	T	11: 57,943,405 (GRCm39)		probably null	Het
Macf1	T	C	4: 123,335,410 (GRCm39)	Y4386C	probably damaging	Het
Mapt	A	G	11: 104,213,138 (GRCm39)		probably null	Het
Neb	C	T	2: 52,172,637 (GRCm39)	V1557I	probably benign	Het
Nid2	A	G	14: 19,847,345 (GRCm39)	T953A	probably benign	Het
Or5b105	T	C	19: 13,080,407 (GRCm39)	D87G	not run	Het
Pax3	G	A	1: 78,099,231 (GRCm39)	Q319*	probably null	Het
Ppp2r1b	T	A	9: 50,773,762 (GRCm39)	S212R	probably benign	Het
Prss29	T	C	17: 25,539,896 (GRCm39)	L98P	probably damaging	Het
Ptch2	T	G	4: 116,967,161 (GRCm39)	L646R	probably damaging	Het
Rasa2	T	A	9: 96,493,474 (GRCm39)	E70V	probably damaging	Het
Serf2	A	G	2: 121,281,256 (GRCm39)	N65S	possibly damaging	Het
Serpinb6b	G	A	13: 33,158,907 (GRCm39)	G155D	probably benign	Het
Serpinb6c	A	G	13: 34,077,875 (GRCm39)	I165T	possibly damaging	Het
Skint5	A	T	4: 113,483,785 (GRCm39)	V949E	unknown	Het
Slc11a2	A	G	15: 100,295,651 (GRCm39)	I490T	possibly damaging	Het
Slx4	T	C	16: 3,803,436 (GRCm39)	D1126G	probably benign	Het
Tent4a	G	T	13: 69,681,823 (GRCm39)	P160Q	probably benign	Het
Tln1	G	T	4: 43,545,206 (GRCm39)	A1003E	possibly damaging	Het
Tmem161b	C	A	13: 84,370,537 (GRCm39)		probably benign	Het
Trav21-dv12	T	C	14: 54,114,072 (GRCm39)	V64A	probably damaging	Het
U2surp	T	C	9: 95,361,402 (GRCm39)	E620G	possibly damaging	Het
Usp3	T	C	9: 66,449,906 (GRCm39)	N179S	possibly damaging	Het
Vps13d	T	C	4: 144,784,108 (GRCm39)	T3889A		Het
Vps35	C	T	8: 85,989,999 (GRCm39)	V670M	probably damaging	Het
Zfp626	T	C	7: 27,517,828 (GRCm39)	S270P	possibly damaging	Het
Zfp955a	C	T	17: 33,461,797 (GRCm39)	V112M	probably benign	Het
Zranb2	T	C	3: 157,246,806 (GRCm39)	S165P	possibly damaging	Het

Other mutations in Dnah7b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Dnah7b	APN	1	46,181,309 (GRCm39)	missense	probably benign	0.04
IGL00796:Dnah7b	APN	1	46,250,497 (GRCm39)	missense	probably damaging	0.96
IGL00825:Dnah7b	APN	1	46,263,811 (GRCm39)	missense	probably damaging	1.00
IGL00910:Dnah7b	APN	1	46,105,889 (GRCm39)	unclassified	probably benign
IGL00950:Dnah7b	APN	1	46,253,482 (GRCm39)	missense	probably benign	0.07
IGL01142:Dnah7b	APN	1	46,234,538 (GRCm39)	critical splice donor site	probably null
IGL01350:Dnah7b	APN	1	46,120,592 (GRCm39)	splice site	probably benign
IGL01392:Dnah7b	APN	1	46,165,948 (GRCm39)	missense	probably damaging	1.00
IGL01403:Dnah7b	APN	1	46,155,460 (GRCm39)	splice site	probably benign
IGL01460:Dnah7b	APN	1	46,178,864 (GRCm39)	missense	possibly damaging	0.82
IGL01576:Dnah7b	APN	1	46,307,813 (GRCm39)	missense	probably damaging	1.00
IGL01693:Dnah7b	APN	1	46,397,307 (GRCm39)	missense	probably benign	0.29
IGL01838:Dnah7b	APN	1	46,397,297 (GRCm39)	nonsense	probably null
IGL01906:Dnah7b	APN	1	46,214,613 (GRCm39)	missense	probably damaging	1.00
IGL01960:Dnah7b	APN	1	46,163,497 (GRCm39)	splice site	probably benign
IGL01989:Dnah7b	APN	1	46,328,694 (GRCm39)	missense	probably damaging	1.00
IGL02127:Dnah7b	APN	1	46,179,035 (GRCm39)	missense	probably benign
IGL02213:Dnah7b	APN	1	46,272,752 (GRCm39)	missense	probably damaging	0.97
IGL02267:Dnah7b	APN	1	46,266,090 (GRCm39)	missense	probably damaging	1.00
IGL02349:Dnah7b	APN	1	46,138,663 (GRCm39)	nonsense	probably null
IGL02381:Dnah7b	APN	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
IGL02473:Dnah7b	APN	1	46,273,353 (GRCm39)	missense	probably damaging	1.00
IGL02484:Dnah7b	APN	1	46,234,478 (GRCm39)	missense	probably damaging	1.00
IGL02590:Dnah7b	APN	1	46,162,937 (GRCm39)	missense	probably benign	0.02
IGL02655:Dnah7b	APN	1	46,155,461 (GRCm39)	splice site	probably benign
IGL02704:Dnah7b	APN	1	46,181,293 (GRCm39)	missense	probably benign	0.03
IGL02719:Dnah7b	APN	1	46,138,768 (GRCm39)	splice site	probably benign
IGL02745:Dnah7b	APN	1	46,234,189 (GRCm39)	splice site	probably benign
IGL02818:Dnah7b	APN	1	46,329,968 (GRCm39)	missense	probably damaging	1.00
IGL02892:Dnah7b	APN	1	46,158,458 (GRCm39)	missense	possibly damaging	0.79
IGL03285:Dnah7b	APN	1	46,221,535 (GRCm39)	missense	probably benign	0.00
IGL03354:Dnah7b	APN	1	46,124,849 (GRCm39)	missense	probably damaging	1.00
IGL03355:Dnah7b	APN	1	46,158,464 (GRCm39)	missense	probably benign	0.18
BB001:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
BB011:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
PIT4305001:Dnah7b	UTSW	1	46,412,508 (GRCm39)	missense	probably damaging	1.00
R0116:Dnah7b	UTSW	1	46,252,520 (GRCm39)	missense	possibly damaging	0.94
R0145:Dnah7b	UTSW	1	46,262,338 (GRCm39)	missense	probably damaging	1.00
R0230:Dnah7b	UTSW	1	46,258,508 (GRCm39)	missense	probably damaging	1.00
R0302:Dnah7b	UTSW	1	46,162,937 (GRCm39)	missense	probably benign	0.26
R0313:Dnah7b	UTSW	1	46,246,803 (GRCm39)	missense	probably damaging	1.00
R0317:Dnah7b	UTSW	1	46,173,816 (GRCm39)	missense	probably damaging	1.00
R0347:Dnah7b	UTSW	1	46,280,104 (GRCm39)	missense	probably damaging	1.00
R0352:Dnah7b	UTSW	1	46,316,286 (GRCm39)	missense	probably damaging	0.98
R0363:Dnah7b	UTSW	1	46,275,948 (GRCm39)	missense	probably damaging	0.99
R0379:Dnah7b	UTSW	1	46,179,336 (GRCm39)	missense	probably benign	0.00
R0502:Dnah7b	UTSW	1	46,258,704 (GRCm39)	missense	probably damaging	0.96
R0602:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0631:Dnah7b	UTSW	1	46,280,152 (GRCm39)	missense	probably benign	0.02
R0664:Dnah7b	UTSW	1	46,364,002 (GRCm39)	missense	probably damaging	1.00
R0882:Dnah7b	UTSW	1	46,379,292 (GRCm39)	missense	probably benign	0.00
R0931:Dnah7b	UTSW	1	46,138,772 (GRCm39)	splice site	probably benign
R1035:Dnah7b	UTSW	1	46,163,608 (GRCm39)	missense	probably benign
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1147:Dnah7b	UTSW	1	46,379,426 (GRCm39)	missense	probably damaging	0.99
R1166:Dnah7b	UTSW	1	46,364,970 (GRCm39)	missense	probably damaging	1.00
R1219:Dnah7b	UTSW	1	46,379,280 (GRCm39)	missense	probably benign	0.00
R1318:Dnah7b	UTSW	1	46,138,669 (GRCm39)	missense	possibly damaging	0.80
R1334:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1429:Dnah7b	UTSW	1	46,328,816 (GRCm39)	missense	possibly damaging	0.84
R1440:Dnah7b	UTSW	1	46,117,753 (GRCm39)	splice site	probably benign
R1484:Dnah7b	UTSW	1	46,176,703 (GRCm39)	missense	probably benign	0.00
R1529:Dnah7b	UTSW	1	46,216,441 (GRCm39)	missense	probably damaging	1.00
R1544:Dnah7b	UTSW	1	46,105,957 (GRCm39)	missense	unknown
R1607:Dnah7b	UTSW	1	46,329,806 (GRCm39)	missense	probably damaging	1.00
R1609:Dnah7b	UTSW	1	46,392,126 (GRCm39)	missense	probably damaging	1.00
R1652:Dnah7b	UTSW	1	46,214,550 (GRCm39)	nonsense	probably null
R1681:Dnah7b	UTSW	1	46,363,872 (GRCm39)	nonsense	probably null
R1716:Dnah7b	UTSW	1	46,230,943 (GRCm39)	missense	probably damaging	1.00
R1753:Dnah7b	UTSW	1	46,361,495 (GRCm39)	missense	probably damaging	0.99
R1834:Dnah7b	UTSW	1	46,272,919 (GRCm39)	missense	possibly damaging	0.90
R1838:Dnah7b	UTSW	1	46,316,265 (GRCm39)	missense	probably damaging	1.00
R1838:Dnah7b	UTSW	1	46,155,337 (GRCm39)	missense	probably benign	0.04
R1898:Dnah7b	UTSW	1	46,275,874 (GRCm39)	missense	probably benign	0.02
R1962:Dnah7b	UTSW	1	46,281,263 (GRCm39)	missense	possibly damaging	0.95
R2001:Dnah7b	UTSW	1	46,181,247 (GRCm39)	missense	possibly damaging	0.69
R2049:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2076:Dnah7b	UTSW	1	46,281,481 (GRCm39)	nonsense	probably null
R2083:Dnah7b	UTSW	1	46,280,227 (GRCm39)	missense	possibly damaging	0.90
R2140:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2141:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2142:Dnah7b	UTSW	1	46,307,830 (GRCm39)	missense	probably damaging	1.00
R2165:Dnah7b	UTSW	1	46,137,152 (GRCm39)	splice site	probably benign
R2172:Dnah7b	UTSW	1	46,163,672 (GRCm39)	missense	probably benign	0.12
R2239:Dnah7b	UTSW	1	46,240,344 (GRCm39)	splice site	probably benign
R2247:Dnah7b	UTSW	1	46,316,223 (GRCm39)	missense	probably damaging	1.00
R2267:Dnah7b	UTSW	1	46,273,075 (GRCm39)	missense	probably damaging	1.00
R2405:Dnah7b	UTSW	1	46,402,114 (GRCm39)	missense	probably benign	0.31
R2509:Dnah7b	UTSW	1	46,234,447 (GRCm39)	missense	probably damaging	0.96
R2895:Dnah7b	UTSW	1	46,178,901 (GRCm39)	missense	probably damaging	1.00
R2965:Dnah7b	UTSW	1	46,246,732 (GRCm39)	missense	probably damaging	1.00
R3013:Dnah7b	UTSW	1	46,227,847 (GRCm39)	critical splice donor site	probably null
R3022:Dnah7b	UTSW	1	46,221,583 (GRCm39)	missense	probably damaging	0.99
R3056:Dnah7b	UTSW	1	46,307,869 (GRCm39)	missense	possibly damaging	0.95
R3107:Dnah7b	UTSW	1	46,392,033 (GRCm39)	missense	probably benign	0.00
R3735:Dnah7b	UTSW	1	46,339,035 (GRCm39)	missense	probably benign	0.05
R3898:Dnah7b	UTSW	1	46,282,417 (GRCm39)	missense	probably damaging	1.00
R3944:Dnah7b	UTSW	1	46,176,645 (GRCm39)	missense	probably damaging	1.00
R3983:Dnah7b	UTSW	1	46,272,871 (GRCm39)	missense	possibly damaging	0.88
R4041:Dnah7b	UTSW	1	46,120,655 (GRCm39)	missense	probably benign
R4172:Dnah7b	UTSW	1	46,266,106 (GRCm39)	missense	probably damaging	1.00
R4210:Dnah7b	UTSW	1	46,176,578 (GRCm39)	missense	possibly damaging	0.63
R4306:Dnah7b	UTSW	1	46,260,932 (GRCm39)	missense	probably damaging	0.99
R4391:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
R4414:Dnah7b	UTSW	1	46,165,840 (GRCm39)	missense	probably benign	0.00
R4495:Dnah7b	UTSW	1	46,124,792 (GRCm39)	missense	probably benign	0.00
R4660:Dnah7b	UTSW	1	46,328,696 (GRCm39)	missense	probably damaging	1.00
R4670:Dnah7b	UTSW	1	46,117,684 (GRCm39)	missense	probably damaging	1.00
R4675:Dnah7b	UTSW	1	46,256,317 (GRCm39)	missense	possibly damaging	0.89
R4685:Dnah7b	UTSW	1	46,250,488 (GRCm39)	missense	probably damaging	1.00
R4727:Dnah7b	UTSW	1	46,246,816 (GRCm39)	missense	probably damaging	1.00
R4735:Dnah7b	UTSW	1	46,106,115 (GRCm39)	missense	unknown
R4780:Dnah7b	UTSW	1	46,392,174 (GRCm39)	missense	probably benign
R4828:Dnah7b	UTSW	1	46,167,272 (GRCm39)	missense	possibly damaging	0.59
R4859:Dnah7b	UTSW	1	46,395,762 (GRCm39)	missense	probably damaging	1.00
R4865:Dnah7b	UTSW	1	46,234,234 (GRCm39)	missense	probably damaging	1.00
R4871:Dnah7b	UTSW	1	46,120,604 (GRCm39)	missense	probably benign	0.21
R4881:Dnah7b	UTSW	1	46,240,478 (GRCm39)	missense	probably damaging	1.00
R4902:Dnah7b	UTSW	1	46,329,935 (GRCm39)	missense	probably benign	0.04
R4960:Dnah7b	UTSW	1	46,272,886 (GRCm39)	missense	probably benign
R5000:Dnah7b	UTSW	1	46,138,663 (GRCm39)	nonsense	probably null
R5005:Dnah7b	UTSW	1	46,281,188 (GRCm39)	missense	probably damaging	0.99
R5026:Dnah7b	UTSW	1	46,226,523 (GRCm39)	missense	probably damaging	0.99
R5080:Dnah7b	UTSW	1	46,221,540 (GRCm39)	nonsense	probably null
R5174:Dnah7b	UTSW	1	46,282,509 (GRCm39)	missense	possibly damaging	0.83
R5178:Dnah7b	UTSW	1	46,397,376 (GRCm39)	missense	possibly damaging	0.50
R5244:Dnah7b	UTSW	1	46,273,018 (GRCm39)	missense	probably damaging	1.00
R5250:Dnah7b	UTSW	1	46,412,514 (GRCm39)	missense	probably damaging	1.00
R5350:Dnah7b	UTSW	1	46,272,849 (GRCm39)	missense	probably benign	0.16
R5380:Dnah7b	UTSW	1	46,256,351 (GRCm39)	missense	probably benign	0.18
R5387:Dnah7b	UTSW	1	46,227,819 (GRCm39)	missense	probably damaging	1.00
R5423:Dnah7b	UTSW	1	46,397,431 (GRCm39)	missense	probably benign	0.01
R5426:Dnah7b	UTSW	1	46,281,366 (GRCm39)	missense	possibly damaging	0.82
R5451:Dnah7b	UTSW	1	46,281,179 (GRCm39)	missense	possibly damaging	0.73
R5459:Dnah7b	UTSW	1	46,148,472 (GRCm39)	missense	probably null
R5479:Dnah7b	UTSW	1	46,262,265 (GRCm39)	missense	probably damaging	1.00
R5583:Dnah7b	UTSW	1	46,281,359 (GRCm39)	missense	probably benign	0.06
R5637:Dnah7b	UTSW	1	46,395,674 (GRCm39)	missense	possibly damaging	0.95
R5641:Dnah7b	UTSW	1	46,307,924 (GRCm39)	splice site	probably null
R5659:Dnah7b	UTSW	1	46,392,009 (GRCm39)	missense	probably damaging	1.00
R5739:Dnah7b	UTSW	1	46,273,152 (GRCm39)	missense	probably damaging	1.00
R5759:Dnah7b	UTSW	1	46,316,280 (GRCm39)	missense	probably damaging	1.00
R5821:Dnah7b	UTSW	1	46,181,292 (GRCm39)	missense	possibly damaging	0.91
R5874:Dnah7b	UTSW	1	46,230,885 (GRCm39)	missense	probably damaging	1.00
R5892:Dnah7b	UTSW	1	46,376,753 (GRCm39)	critical splice donor site	probably null
R5918:Dnah7b	UTSW	1	46,260,803 (GRCm39)	missense	probably benign
R5941:Dnah7b	UTSW	1	46,226,450 (GRCm39)	missense	probably damaging	1.00
R5965:Dnah7b	UTSW	1	46,402,147 (GRCm39)	missense	probably damaging	1.00
R5987:Dnah7b	UTSW	1	46,158,558 (GRCm39)	splice site	probably null
R6041:Dnah7b	UTSW	1	46,328,805 (GRCm39)	missense	probably benign	0.04
R6043:Dnah7b	UTSW	1	46,178,949 (GRCm39)	missense	probably benign
R6049:Dnah7b	UTSW	1	46,124,762 (GRCm39)	missense	probably benign
R6131:Dnah7b	UTSW	1	46,292,626 (GRCm39)	missense	probably damaging	1.00
R6168:Dnah7b	UTSW	1	46,329,863 (GRCm39)	missense	probably damaging	1.00
R6195:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6219:Dnah7b	UTSW	1	46,272,745 (GRCm39)	missense	probably benign	0.03
R6226:Dnah7b	UTSW	1	46,165,828 (GRCm39)	missense	probably benign	0.01
R6233:Dnah7b	UTSW	1	46,243,429 (GRCm39)	missense	probably damaging	1.00
R6247:Dnah7b	UTSW	1	46,265,048 (GRCm39)	missense	probably benign
R6273:Dnah7b	UTSW	1	46,281,476 (GRCm39)	missense	possibly damaging	0.94
R6279:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6300:Dnah7b	UTSW	1	46,365,046 (GRCm39)	missense	probably damaging	1.00
R6330:Dnah7b	UTSW	1	46,379,335 (GRCm39)	missense	probably damaging	1.00
R6476:Dnah7b	UTSW	1	46,281,364 (GRCm39)	nonsense	probably null
R6494:Dnah7b	UTSW	1	46,138,591 (GRCm39)	missense	probably damaging	1.00
R6762:Dnah7b	UTSW	1	46,263,902 (GRCm39)	missense	probably benign	0.12
R6800:Dnah7b	UTSW	1	46,379,377 (GRCm39)	missense	possibly damaging	0.90
R6838:Dnah7b	UTSW	1	46,230,948 (GRCm39)	missense	probably damaging	1.00
R6937:Dnah7b	UTSW	1	46,234,280 (GRCm39)	missense	probably damaging	1.00
R6940:Dnah7b	UTSW	1	46,158,428 (GRCm39)	missense	probably benign	0.12
R6969:Dnah7b	UTSW	1	46,397,398 (GRCm39)	missense	probably damaging	1.00
R6993:Dnah7b	UTSW	1	46,234,299 (GRCm39)	critical splice donor site	probably null
R7040:Dnah7b	UTSW	1	46,275,969 (GRCm39)	missense	probably benign	0.01
R7117:Dnah7b	UTSW	1	46,391,973 (GRCm39)	critical splice acceptor site	probably null
R7135:Dnah7b	UTSW	1	46,178,870 (GRCm39)	missense	probably damaging	0.99
R7153:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.05
R7189:Dnah7b	UTSW	1	46,281,302 (GRCm39)	missense	probably damaging	1.00
R7237:Dnah7b	UTSW	1	46,179,126 (GRCm39)	missense	probably damaging	0.98
R7243:Dnah7b	UTSW	1	46,122,914 (GRCm39)	missense	probably benign
R7244:Dnah7b	UTSW	1	46,316,303 (GRCm39)	missense	probably damaging	0.99
R7248:Dnah7b	UTSW	1	46,181,245 (GRCm39)	missense	possibly damaging	0.83
R7318:Dnah7b	UTSW	1	46,234,532 (GRCm39)	missense	probably damaging	1.00
R7375:Dnah7b	UTSW	1	46,342,794 (GRCm39)	missense	probably damaging	1.00
R7483:Dnah7b	UTSW	1	46,214,579 (GRCm39)	missense	probably damaging	1.00
R7486:Dnah7b	UTSW	1	46,329,894 (GRCm39)	missense	probably damaging	1.00
R7498:Dnah7b	UTSW	1	46,364,925 (GRCm39)	missense	probably damaging	1.00
R7501:Dnah7b	UTSW	1	46,395,714 (GRCm39)	missense	probably damaging	1.00
R7513:Dnah7b	UTSW	1	46,163,506 (GRCm39)	missense	probably benign	0.06
R7620:Dnah7b	UTSW	1	46,307,794 (GRCm39)	missense	probably damaging	1.00
R7670:Dnah7b	UTSW	1	46,148,462 (GRCm39)	missense	probably benign
R7676:Dnah7b	UTSW	1	46,273,324 (GRCm39)	nonsense	probably null
R7731:Dnah7b	UTSW	1	46,178,905 (GRCm39)	missense	probably benign	0.00
R7760:Dnah7b	UTSW	1	46,240,413 (GRCm39)	missense	probably damaging	1.00
R7768:Dnah7b	UTSW	1	46,176,634 (GRCm39)	missense	probably benign
R7807:Dnah7b	UTSW	1	46,253,527 (GRCm39)	missense	probably benign
R7895:Dnah7b	UTSW	1	46,289,110 (GRCm39)	missense	probably damaging	1.00
R7911:Dnah7b	UTSW	1	46,178,838 (GRCm39)	missense	probably damaging	1.00
R7924:Dnah7b	UTSW	1	46,258,590 (GRCm39)	missense	probably benign	0.04
R7944:Dnah7b	UTSW	1	46,266,163 (GRCm39)	missense	probably benign
R7946:Dnah7b	UTSW	1	46,272,739 (GRCm39)	missense	probably damaging	1.00
R7983:Dnah7b	UTSW	1	46,282,584 (GRCm39)	missense	probably damaging	1.00
R8012:Dnah7b	UTSW	1	46,282,525 (GRCm39)	missense	probably damaging	1.00
R8069:Dnah7b	UTSW	1	46,263,866 (GRCm39)	nonsense	probably null
R8094:Dnah7b	UTSW	1	46,165,964 (GRCm39)	missense	probably benign	0.01
R8137:Dnah7b	UTSW	1	46,272,913 (GRCm39)	missense	probably damaging	1.00
R8167:Dnah7b	UTSW	1	46,292,671 (GRCm39)	missense	possibly damaging	0.95
R8268:Dnah7b	UTSW	1	46,395,736 (GRCm39)	missense	probably benign	0.43
R8309:Dnah7b	UTSW	1	46,179,032 (GRCm39)	missense	probably damaging	1.00
R8313:Dnah7b	UTSW	1	46,214,456 (GRCm39)	missense	possibly damaging	0.81
R8410:Dnah7b	UTSW	1	46,395,819 (GRCm39)	critical splice donor site	probably null
R8438:Dnah7b	UTSW	1	46,227,839 (GRCm39)	missense	probably damaging	1.00
R8446:Dnah7b	UTSW	1	46,329,875 (GRCm39)	missense	probably damaging	1.00
R8471:Dnah7b	UTSW	1	46,138,650 (GRCm39)	missense	possibly damaging	0.92
R8551:Dnah7b	UTSW	1	46,155,360 (GRCm39)	missense	possibly damaging	0.94
R8711:Dnah7b	UTSW	1	46,214,598 (GRCm39)	missense	probably damaging	1.00
R8745:Dnah7b	UTSW	1	46,221,624 (GRCm39)	missense	possibly damaging	0.82
R8765:Dnah7b	UTSW	1	46,392,159 (GRCm39)	missense	possibly damaging	0.91
R8797:Dnah7b	UTSW	1	46,162,806 (GRCm39)	missense	probably damaging	1.00
R8805:Dnah7b	UTSW	1	46,273,305 (GRCm39)	missense	possibly damaging	0.90
R8830:Dnah7b	UTSW	1	46,230,953 (GRCm39)	missense	probably damaging	1.00
R8861:Dnah7b	UTSW	1	46,280,236 (GRCm39)	missense	possibly damaging	0.82
R8905:Dnah7b	UTSW	1	46,292,534 (GRCm39)	missense	probably damaging	0.99
R9009:Dnah7b	UTSW	1	46,262,232 (GRCm39)	missense	probably benign	0.00
R9058:Dnah7b	UTSW	1	46,282,575 (GRCm39)	missense	probably damaging	1.00
R9130:Dnah7b	UTSW	1	46,173,674 (GRCm39)	missense	probably benign	0.01
R9131:Dnah7b	UTSW	1	46,266,180 (GRCm39)	missense	probably damaging	1.00
R9181:Dnah7b	UTSW	1	46,181,194 (GRCm39)	missense	probably damaging	1.00
R9182:Dnah7b	UTSW	1	46,330,038 (GRCm39)	missense	probably benign	0.06
R9223:Dnah7b	UTSW	1	46,361,420 (GRCm39)	missense	probably benign	0.12
R9391:Dnah7b	UTSW	1	46,272,914 (GRCm39)	nonsense	probably null
R9392:Dnah7b	UTSW	1	46,162,898 (GRCm39)	nonsense	probably null
R9456:Dnah7b	UTSW	1	46,165,953 (GRCm39)	missense	possibly damaging	0.82
R9498:Dnah7b	UTSW	1	46,253,564 (GRCm39)	missense	probably benign	0.27
R9553:Dnah7b	UTSW	1	46,264,956 (GRCm39)	missense	probably damaging	0.99
R9598:Dnah7b	UTSW	1	46,292,621 (GRCm39)	missense	possibly damaging	0.67
R9653:Dnah7b	UTSW	1	46,252,544 (GRCm39)	missense	possibly damaging	0.55
R9781:Dnah7b	UTSW	1	46,376,754 (GRCm39)	splice site	probably null
RF020:Dnah7b	UTSW	1	46,412,421 (GRCm39)	missense	possibly damaging	0.84
V8831:Dnah7b	UTSW	1	46,412,458 (GRCm39)	nonsense	probably null
X0023:Dnah7b	UTSW	1	46,342,737 (GRCm39)	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TGAAGCAATGGAACGTTTTGAGC -3'
(R):5'- GCCTGAGAAGATTTGTACCAAG -3'

Sequencing Primer
(F):5'- TGAGCAGTACTTGGATGCTAACC -3'
(R):5'- CTGAGAAGATTTGTACCAAGGAAAAG -3'

Posted On

2019-10-17