Incidental Mutation 'R7547:Serf2'
ID584242
Institutional Source Beutler Lab
Gene Symbol Serf2
Ensembl Gene ENSMUSG00000074884
Gene Namesmall EDRK-rich factor 2
Synonyms4F5rel (4F5 related), m4F5rel
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7547 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location121449195-121458313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121450775 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 65 (N65S)
Ref Sequence ENSEMBL: ENSMUSP00000097074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056312] [ENSMUST00000099475] [ENSMUST00000110612] [ENSMUST00000110613] [ENSMUST00000110615] [ENSMUST00000139253] [ENSMUST00000148575] [ENSMUST00000154418]
Predicted Effect probably benign
Transcript: ENSMUST00000056312
SMART Domains Protein: ENSMUSP00000051261
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 33 488 3e-125 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099475
AA Change: N65S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097074
Gene: ENSMUSG00000074884
AA Change: N65S

DomainStartEndE-ValueType
Pfam:4F5 1 38 3.1e-14 PFAM
low complexity region 49 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110612
SMART Domains Protein: ENSMUSP00000106242
Gene: ENSMUSG00000027245

DomainStartEndE-ValueType
coiled coil region 69 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110613
SMART Domains Protein: ENSMUSP00000106243
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 34 280 5.6e-67 PFAM
low complexity region 342 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110615
Predicted Effect probably benign
Transcript: ENSMUST00000127435
SMART Domains Protein: ENSMUSP00000119373
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 192 7.7e-61 PFAM
Predicted Effect silent
Transcript: ENSMUST00000139253
SMART Domains Protein: ENSMUSP00000123181
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 1e-14 PFAM
low complexity region 45 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140135
SMART Domains Protein: ENSMUSP00000117054
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 1 75 8.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140752
SMART Domains Protein: ENSMUSP00000116676
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 78 7.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148575
SMART Domains Protein: ENSMUSP00000121895
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 2.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154418
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,109,269 D146E probably benign Het
Adgrl1 C T 8: 83,938,884 A1400V probably benign Het
Ank2 A G 3: 126,945,203 V2344A unknown Het
Aplnr A T 2: 85,137,177 D182V probably damaging Het
Asb4 C T 6: 5,398,350 P105L probably damaging Het
Ate1 C A 7: 130,504,809 R274I probably benign Het
Ccdc43 A G 11: 102,692,122 V92A probably benign Het
Cfap69 T A 5: 5,604,290 N548I possibly damaging Het
Clpb A G 7: 101,664,296 probably null Het
Ctnnal1 G A 4: 56,817,032 R597C probably damaging Het
Dchs2 A G 3: 83,356,127 K3234R probably damaging Het
Dnah7a T A 1: 53,663,837 K151N probably benign Het
Dnah7b T A 1: 46,214,413 I1826K possibly damaging Het
Dnttip1 A G 2: 164,767,879 K289E probably benign Het
Eppk1 G T 15: 76,107,540 Q1714K probably benign Het
Exoc4 A G 6: 33,839,121 D674G possibly damaging Het
Galnt7 A T 8: 57,583,962 V131D possibly damaging Het
Glg1 C T 8: 111,187,761 V464M possibly damaging Het
Gm36079 A T 13: 120,026,921 F31I probably damaging Het
Hlcs G T 16: 94,231,172 S444* probably null Het
Larp1 G T 11: 58,052,579 probably null Het
Macf1 T C 4: 123,441,617 Y4386C probably damaging Het
Mapt A G 11: 104,322,312 probably null Het
Neb C T 2: 52,282,625 V1557I probably benign Het
Nid2 A G 14: 19,797,277 T953A probably benign Het
Olfr1458 T C 19: 13,103,043 D87G not run Het
Papd7 G T 13: 69,533,704 P160Q probably benign Het
Pax3 G A 1: 78,122,594 Q319* probably null Het
Ppp2r1b T A 9: 50,862,462 S212R probably benign Het
Prss29 T C 17: 25,320,922 L98P probably damaging Het
Ptch2 T G 4: 117,109,964 L646R probably damaging Het
Rasa2 T A 9: 96,611,421 E70V probably damaging Het
Serpinb6b G A 13: 32,974,924 G155D probably benign Het
Serpinb6c A G 13: 33,893,892 I165T possibly damaging Het
Skint5 A T 4: 113,626,588 V949E unknown Het
Slc11a2 A G 15: 100,397,770 I490T possibly damaging Het
Slx4 T C 16: 3,985,572 D1126G probably benign Het
Tln1 G T 4: 43,545,206 A1003E possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav21-dv12 T C 14: 53,876,615 V64A probably damaging Het
U2surp T C 9: 95,479,349 E620G possibly damaging Het
Usp3 T C 9: 66,542,624 N179S possibly damaging Het
Vps13d T C 4: 145,057,538 T3889A Het
Vps35 C T 8: 85,263,370 V670M probably damaging Het
Zfp626 T C 7: 27,818,403 S270P possibly damaging Het
Zfp955a C T 17: 33,242,823 V112M probably benign Het
Zranb2 T C 3: 157,541,169 S165P possibly damaging Het
Other mutations in Serf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Serf2 APN 2 121457703 critical splice donor site probably null
R0615:Serf2 UTSW 2 121450855 missense probably benign 0.18
R5117:Serf2 UTSW 2 121450703 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCATATGCTGAACTTTGTCC -3'
(R):5'- ACCAGGCGCTCAAGGAATTAC -3'

Sequencing Primer
(F):5'- ATATGCTGAACTTTGTCCCATCCAC -3'
(R):5'- GGCGCTCAAGGAATTACAAAGCTAC -3'
Posted On2019-10-17