Incidental Mutation 'R7547:Abca1'
ID584248
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7547 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53109269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 146 (D146E)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably benign
Transcript: ENSMUST00000030010
AA Change: D146E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: D146E

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 C T 8: 83,938,884 A1400V probably benign Het
Ank2 A G 3: 126,945,203 V2344A unknown Het
Aplnr A T 2: 85,137,177 D182V probably damaging Het
Asb4 C T 6: 5,398,350 P105L probably damaging Het
Ate1 C A 7: 130,504,809 R274I probably benign Het
Ccdc43 A G 11: 102,692,122 V92A probably benign Het
Cfap69 T A 5: 5,604,290 N548I possibly damaging Het
Clpb A G 7: 101,664,296 probably null Het
Ctnnal1 G A 4: 56,817,032 R597C probably damaging Het
Dchs2 A G 3: 83,356,127 K3234R probably damaging Het
Dnah7a T A 1: 53,663,837 K151N probably benign Het
Dnah7b T A 1: 46,214,413 I1826K possibly damaging Het
Dnttip1 A G 2: 164,767,879 K289E probably benign Het
Eppk1 G T 15: 76,107,540 Q1714K probably benign Het
Exoc4 A G 6: 33,839,121 D674G possibly damaging Het
Galnt7 A T 8: 57,583,962 V131D possibly damaging Het
Glg1 C T 8: 111,187,761 V464M possibly damaging Het
Gm36079 A T 13: 120,026,921 F31I probably damaging Het
Hlcs G T 16: 94,231,172 S444* probably null Het
Larp1 G T 11: 58,052,579 probably null Het
Macf1 T C 4: 123,441,617 Y4386C probably damaging Het
Mapt A G 11: 104,322,312 probably null Het
Neb C T 2: 52,282,625 V1557I probably benign Het
Nid2 A G 14: 19,797,277 T953A probably benign Het
Olfr1458 T C 19: 13,103,043 D87G not run Het
Papd7 G T 13: 69,533,704 P160Q probably benign Het
Pax3 G A 1: 78,122,594 Q319* probably null Het
Ppp2r1b T A 9: 50,862,462 S212R probably benign Het
Prss29 T C 17: 25,320,922 L98P probably damaging Het
Ptch2 T G 4: 117,109,964 L646R probably damaging Het
Rasa2 T A 9: 96,611,421 E70V probably damaging Het
Serf2 A G 2: 121,450,775 N65S possibly damaging Het
Serpinb6b G A 13: 32,974,924 G155D probably benign Het
Serpinb6c A G 13: 33,893,892 I165T possibly damaging Het
Skint5 A T 4: 113,626,588 V949E unknown Het
Slc11a2 A G 15: 100,397,770 I490T possibly damaging Het
Slx4 T C 16: 3,985,572 D1126G probably benign Het
Tln1 G T 4: 43,545,206 A1003E possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav21-dv12 T C 14: 53,876,615 V64A probably damaging Het
U2surp T C 9: 95,479,349 E620G possibly damaging Het
Usp3 T C 9: 66,542,624 N179S possibly damaging Het
Vps13d T C 4: 145,057,538 T3889A Het
Vps35 C T 8: 85,263,370 V670M probably damaging Het
Zfp626 T C 7: 27,818,403 S270P possibly damaging Het
Zfp955a C T 17: 33,242,823 V112M probably benign Het
Zranb2 T C 3: 157,541,169 S165P possibly damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCTGACCATTTCCTTCACAG -3'
(R):5'- CCTGAAACTCACTTCTCGGTG -3'

Sequencing Primer
(F):5'- CAGCTTTTTCAAAGGCCAGG -3'
(R):5'- CCATAGCGGTTGAGTCTT -3'
Posted On2019-10-17