Incidental Mutation 'R7547:Zfp626'
ID584257
Institutional Source Beutler Lab
Gene Symbol Zfp626
Ensembl Gene ENSMUSG00000030604
Gene Namezinc finger protein 626
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R7547 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27807196-27822916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27818403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 270 (S270P)
Ref Sequence ENSEMBL: ENSMUSP00000146286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080175] [ENSMUST00000205671]
Predicted Effect probably damaging
Transcript: ENSMUST00000080175
AA Change: S196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079068
Gene: ENSMUSG00000030604
AA Change: S196P

DomainStartEndE-ValueType
ZnF_C2H2 99 121 1.16e-1 SMART
ZnF_C2H2 127 149 8.98e0 SMART
ZnF_C2H2 155 177 5.42e-2 SMART
ZnF_C2H2 183 205 3.39e-3 SMART
ZnF_C2H2 211 233 3.69e-4 SMART
ZnF_C2H2 239 261 4.72e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205671
AA Change: S270P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,109,269 D146E probably benign Het
Adgrl1 C T 8: 83,938,884 A1400V probably benign Het
Ank2 A G 3: 126,945,203 V2344A unknown Het
Aplnr A T 2: 85,137,177 D182V probably damaging Het
Asb4 C T 6: 5,398,350 P105L probably damaging Het
Ate1 C A 7: 130,504,809 R274I probably benign Het
Ccdc43 A G 11: 102,692,122 V92A probably benign Het
Cfap69 T A 5: 5,604,290 N548I possibly damaging Het
Clpb A G 7: 101,664,296 probably null Het
Ctnnal1 G A 4: 56,817,032 R597C probably damaging Het
Dchs2 A G 3: 83,356,127 K3234R probably damaging Het
Dnah7a T A 1: 53,663,837 K151N probably benign Het
Dnah7b T A 1: 46,214,413 I1826K possibly damaging Het
Dnttip1 A G 2: 164,767,879 K289E probably benign Het
Eppk1 G T 15: 76,107,540 Q1714K probably benign Het
Exoc4 A G 6: 33,839,121 D674G possibly damaging Het
Galnt7 A T 8: 57,583,962 V131D possibly damaging Het
Glg1 C T 8: 111,187,761 V464M possibly damaging Het
Gm36079 A T 13: 120,026,921 F31I probably damaging Het
Hlcs G T 16: 94,231,172 S444* probably null Het
Larp1 G T 11: 58,052,579 probably null Het
Macf1 T C 4: 123,441,617 Y4386C probably damaging Het
Mapt A G 11: 104,322,312 probably null Het
Neb C T 2: 52,282,625 V1557I probably benign Het
Nid2 A G 14: 19,797,277 T953A probably benign Het
Olfr1458 T C 19: 13,103,043 D87G not run Het
Papd7 G T 13: 69,533,704 P160Q probably benign Het
Pax3 G A 1: 78,122,594 Q319* probably null Het
Ppp2r1b T A 9: 50,862,462 S212R probably benign Het
Prss29 T C 17: 25,320,922 L98P probably damaging Het
Ptch2 T G 4: 117,109,964 L646R probably damaging Het
Rasa2 T A 9: 96,611,421 E70V probably damaging Het
Serf2 A G 2: 121,450,775 N65S possibly damaging Het
Serpinb6b G A 13: 32,974,924 G155D probably benign Het
Serpinb6c A G 13: 33,893,892 I165T possibly damaging Het
Skint5 A T 4: 113,626,588 V949E unknown Het
Slc11a2 A G 15: 100,397,770 I490T possibly damaging Het
Slx4 T C 16: 3,985,572 D1126G probably benign Het
Tln1 G T 4: 43,545,206 A1003E possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav21-dv12 T C 14: 53,876,615 V64A probably damaging Het
U2surp T C 9: 95,479,349 E620G possibly damaging Het
Usp3 T C 9: 66,542,624 N179S possibly damaging Het
Vps13d T C 4: 145,057,538 T3889A Het
Vps35 C T 8: 85,263,370 V670M probably damaging Het
Zfp955a C T 17: 33,242,823 V112M probably benign Het
Zranb2 T C 3: 157,541,169 S165P possibly damaging Het
Other mutations in Zfp626
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0726:Zfp626 UTSW 7 27818623 missense probably damaging 1.00
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0973:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R0974:Zfp626 UTSW 7 27818482 missense probably damaging 0.97
R3085:Zfp626 UTSW 7 27818162 missense probably benign 0.12
R5421:Zfp626 UTSW 7 27817910 missense probably damaging 0.97
R6213:Zfp626 UTSW 7 27808292 missense probably benign 0.00
R6950:Zfp626 UTSW 7 27818914 missense probably damaging 1.00
R7190:Zfp626 UTSW 7 27818343 missense probably benign
R7359:Zfp626 UTSW 7 27808235 missense probably damaging 1.00
R7783:Zfp626 UTSW 7 27818370 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACAGTGTGGGAAGTGCTTC -3'
(R):5'- TGAAGCTTAAGCCGGTCAGG -3'

Sequencing Primer
(F):5'- CAGCATCAGAGTGTTCATGC -3'
(R):5'- AGGAGTCTGAAGGCCTTTCCAC -3'
Posted On2019-10-17