Incidental Mutation 'R7547:Usp3'
ID584264
Institutional Source Beutler Lab
Gene Symbol Usp3
Ensembl Gene ENSMUSG00000032376
Gene Nameubiquitin specific peptidase 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7547 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location66514637-66593142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66542624 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 179 (N179S)
Ref Sequence ENSEMBL: ENSMUSP00000122199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098613] [ENSMUST00000127569] [ENSMUST00000139547] [ENSMUST00000174387]
Predicted Effect probably benign
Transcript: ENSMUST00000098613
SMART Domains Protein: ENSMUSP00000096213
Gene: ENSMUSG00000032376

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 6.6e-23 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 188 1.1e-8 PFAM
Pfam:UCH 178 470 4.2e-54 PFAM
Pfam:UCH_1 193 452 3.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127569
AA Change: N179S

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122199
Gene: ENSMUSG00000032376
AA Change: N179S

DomainStartEndE-ValueType
Pfam:zf-UBP 29 107 1.2e-22 PFAM
low complexity region 135 150 N/A INTRINSIC
Pfam:UCH 158 508 2.5e-61 PFAM
Pfam:UCH_1 206 490 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139547
Predicted Effect possibly damaging
Transcript: ENSMUST00000174387
AA Change: N135S

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134472
Gene: ENSMUSG00000032376
AA Change: N135S

DomainStartEndE-ValueType
Pfam:zf-UBP 29 142 1.6e-7 PFAM
Pfam:UCH 114 464 9.9e-69 PFAM
Pfam:UCH_1 115 446 2e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a chromatin-associated histone 2A and 2B deubiquitinating enzyme that negatively regulates the DNA damage response. Mice deficient for this enzyme have reduced hematopoietic stem cell reserves, demonstrating a requirement in hematopoietic stem cell homeostasis. In addition, knock down of protein levels results in spontaneous tumor development and shortened lifespan, consistent with a function in preserving chromosomal integrity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,109,269 D146E probably benign Het
Adgrl1 C T 8: 83,938,884 A1400V probably benign Het
Ank2 A G 3: 126,945,203 V2344A unknown Het
Aplnr A T 2: 85,137,177 D182V probably damaging Het
Asb4 C T 6: 5,398,350 P105L probably damaging Het
Ate1 C A 7: 130,504,809 R274I probably benign Het
Ccdc43 A G 11: 102,692,122 V92A probably benign Het
Cfap69 T A 5: 5,604,290 N548I possibly damaging Het
Clpb A G 7: 101,664,296 probably null Het
Ctnnal1 G A 4: 56,817,032 R597C probably damaging Het
Dchs2 A G 3: 83,356,127 K3234R probably damaging Het
Dnah7a T A 1: 53,663,837 K151N probably benign Het
Dnah7b T A 1: 46,214,413 I1826K possibly damaging Het
Dnttip1 A G 2: 164,767,879 K289E probably benign Het
Eppk1 G T 15: 76,107,540 Q1714K probably benign Het
Exoc4 A G 6: 33,839,121 D674G possibly damaging Het
Galnt7 A T 8: 57,583,962 V131D possibly damaging Het
Glg1 C T 8: 111,187,761 V464M possibly damaging Het
Gm36079 A T 13: 120,026,921 F31I probably damaging Het
Hlcs G T 16: 94,231,172 S444* probably null Het
Larp1 G T 11: 58,052,579 probably null Het
Macf1 T C 4: 123,441,617 Y4386C probably damaging Het
Mapt A G 11: 104,322,312 probably null Het
Neb C T 2: 52,282,625 V1557I probably benign Het
Nid2 A G 14: 19,797,277 T953A probably benign Het
Olfr1458 T C 19: 13,103,043 D87G not run Het
Papd7 G T 13: 69,533,704 P160Q probably benign Het
Pax3 G A 1: 78,122,594 Q319* probably null Het
Ppp2r1b T A 9: 50,862,462 S212R probably benign Het
Prss29 T C 17: 25,320,922 L98P probably damaging Het
Ptch2 T G 4: 117,109,964 L646R probably damaging Het
Rasa2 T A 9: 96,611,421 E70V probably damaging Het
Serf2 A G 2: 121,450,775 N65S possibly damaging Het
Serpinb6b G A 13: 32,974,924 G155D probably benign Het
Serpinb6c A G 13: 33,893,892 I165T possibly damaging Het
Skint5 A T 4: 113,626,588 V949E unknown Het
Slc11a2 A G 15: 100,397,770 I490T possibly damaging Het
Slx4 T C 16: 3,985,572 D1126G probably benign Het
Tln1 G T 4: 43,545,206 A1003E possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav21-dv12 T C 14: 53,876,615 V64A probably damaging Het
U2surp T C 9: 95,479,349 E620G possibly damaging Het
Vps13d T C 4: 145,057,538 T3889A Het
Vps35 C T 8: 85,263,370 V670M probably damaging Het
Zfp626 T C 7: 27,818,403 S270P possibly damaging Het
Zfp955a C T 17: 33,242,823 V112M probably benign Het
Zranb2 T C 3: 157,541,169 S165P possibly damaging Het
Other mutations in Usp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Usp3 APN 9 66562552 critical splice donor site probably null
IGL02951:Usp3 APN 9 66542550 nonsense probably null
IGL03283:Usp3 APN 9 66562549 splice site probably null
R0148:Usp3 UTSW 9 66540167 missense possibly damaging 0.80
R0152:Usp3 UTSW 9 66540150 missense probably damaging 0.97
R0184:Usp3 UTSW 9 66562581 missense probably damaging 0.99
R0628:Usp3 UTSW 9 66518444 missense probably benign 0.05
R1036:Usp3 UTSW 9 66530231 splice site probably benign
R2251:Usp3 UTSW 9 66562578 missense probably damaging 0.99
R2437:Usp3 UTSW 9 66545742 critical splice donor site probably null
R3957:Usp3 UTSW 9 66562591 missense probably benign 0.04
R4320:Usp3 UTSW 9 66530248 missense possibly damaging 0.80
R4439:Usp3 UTSW 9 66518494 missense probably benign 0.00
R4562:Usp3 UTSW 9 66520765 intron probably benign
R4659:Usp3 UTSW 9 66527070 intron probably null
R4742:Usp3 UTSW 9 66520677 missense probably damaging 1.00
R5134:Usp3 UTSW 9 66542532 missense possibly damaging 0.82
R5242:Usp3 UTSW 9 66527150 missense probably damaging 1.00
R5556:Usp3 UTSW 9 66544021 missense possibly damaging 0.88
R6949:Usp3 UTSW 9 66520690 missense probably benign 0.37
R7440:Usp3 UTSW 9 66530255 missense probably benign 0.03
R7452:Usp3 UTSW 9 66566898 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCCTTCCCGTTATAATAGCAG -3'
(R):5'- CAGAGCTGTACTTCTGTGCG -3'

Sequencing Primer
(F):5'- CTAGATTAATGCGATTTAGGAAGAGC -3'
(R):5'- CGTTTCTCGGAGTGAGGGAAGAG -3'
Posted On2019-10-17