Incidental Mutation 'R7547:Serpinb6c'
ID 584270
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7547 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33893892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 165 (I165T)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
AlphaFold W4VSP4
Predicted Effect possibly damaging
Transcript: ENSMUST00000110273
AA Change: I165T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: I165T

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172184
AA Change: I165T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: I165T

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000222216
AA Change: I165T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,109,269 D146E probably benign Het
Adgrl1 C T 8: 83,938,884 A1400V probably benign Het
Ank2 A G 3: 126,945,203 V2344A unknown Het
Aplnr A T 2: 85,137,177 D182V probably damaging Het
Asb4 C T 6: 5,398,350 P105L probably damaging Het
Ate1 C A 7: 130,504,809 R274I probably benign Het
Ccdc43 A G 11: 102,692,122 V92A probably benign Het
Cfap69 T A 5: 5,604,290 N548I possibly damaging Het
Clpb A G 7: 101,664,296 probably null Het
Ctnnal1 G A 4: 56,817,032 R597C probably damaging Het
Dchs2 A G 3: 83,356,127 K3234R probably damaging Het
Dnah7a T A 1: 53,663,837 K151N probably benign Het
Dnah7b T A 1: 46,214,413 I1826K possibly damaging Het
Dnttip1 A G 2: 164,767,879 K289E probably benign Het
Eppk1 G T 15: 76,107,540 Q1714K probably benign Het
Exoc4 A G 6: 33,839,121 D674G possibly damaging Het
Galnt7 A T 8: 57,583,962 V131D possibly damaging Het
Glg1 C T 8: 111,187,761 V464M possibly damaging Het
Gm36079 A T 13: 120,026,921 F31I probably damaging Het
Hlcs G T 16: 94,231,172 S444* probably null Het
Larp1 G T 11: 58,052,579 probably null Het
Macf1 T C 4: 123,441,617 Y4386C probably damaging Het
Mapt A G 11: 104,322,312 probably null Het
Neb C T 2: 52,282,625 V1557I probably benign Het
Nid2 A G 14: 19,797,277 T953A probably benign Het
Olfr1458 T C 19: 13,103,043 D87G not run Het
Papd7 G T 13: 69,533,704 P160Q probably benign Het
Pax3 G A 1: 78,122,594 Q319* probably null Het
Ppp2r1b T A 9: 50,862,462 S212R probably benign Het
Prss29 T C 17: 25,320,922 L98P probably damaging Het
Ptch2 T G 4: 117,109,964 L646R probably damaging Het
Rasa2 T A 9: 96,611,421 E70V probably damaging Het
Serf2 A G 2: 121,450,775 N65S possibly damaging Het
Serpinb6b G A 13: 32,974,924 G155D probably benign Het
Skint5 A T 4: 113,626,588 V949E unknown Het
Slc11a2 A G 15: 100,397,770 I490T possibly damaging Het
Slx4 T C 16: 3,985,572 D1126G probably benign Het
Tln1 G T 4: 43,545,206 A1003E possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trav21-dv12 T C 14: 53,876,615 V64A probably damaging Het
U2surp T C 9: 95,479,349 E620G possibly damaging Het
Usp3 T C 9: 66,542,624 N179S possibly damaging Het
Vps13d T C 4: 145,057,538 T3889A Het
Vps35 C T 8: 85,263,370 V670M probably damaging Het
Zfp626 T C 7: 27,818,403 S270P possibly damaging Het
Zfp955a C T 17: 33,242,823 V112M probably benign Het
Zranb2 T C 3: 157,541,169 S165P possibly damaging Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
R8855:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R8866:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R9412:Serpinb6c UTSW 13 33897388 missense not run
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAGGCTACATGAGGAACCTC -3'
(R):5'- CAGCCACTTTTGTTAGGTAATTGGG -3'

Sequencing Primer
(F):5'- CCTCCTTATGTTTTAGAAACCAGTG -3'
(R):5'- TTGCTATGAAGAGACACCCTG -3'
Posted On 2019-10-17