Incidental Mutation 'R7548:Atp8a1'
ID584298
Institutional Source Beutler Lab
Gene Symbol Atp8a1
Ensembl Gene ENSMUSG00000037685
Gene NameATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1
SynonymsB230107D19Rik, Atp3a2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7548 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67618140-67847434 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67815728 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 26 (R26*)
Ref Sequence ENSEMBL: ENSMUSP00000121630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037380] [ENSMUST00000072971] [ENSMUST00000113651] [ENSMUST00000113652] [ENSMUST00000135930] [ENSMUST00000141443] [ENSMUST00000200955]
Predicted Effect probably benign
Transcript: ENSMUST00000037380
SMART Domains Protein: ENSMUSP00000042215
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 9.8e-27 PFAM
Pfam:E1-E2_ATPase 106 371 3e-11 PFAM
Pfam:HAD 406 810 3.8e-23 PFAM
Pfam:Cation_ATPase 485 585 6e-14 PFAM
Pfam:PhoLip_ATPase_C 827 1079 8.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072971
SMART Domains Protein: ENSMUSP00000072738
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 104 375 2.1e-22 PFAM
Pfam:Hydrolase 403 798 2.2e-14 PFAM
Pfam:HAD 406 795 3e-18 PFAM
Pfam:Hydrolase_like2 470 570 4.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113651
SMART Domains Protein: ENSMUSP00000109281
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Blast:CUB 46 87 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113652
SMART Domains Protein: ENSMUSP00000109282
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Blast:CUB 46 87 9e-6 BLAST
Pfam:E1-E2_ATPase 104 175 6.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135930
SMART Domains Protein: ENSMUSP00000118379
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 1.1e-26 PFAM
Pfam:E1-E2_ATPase 106 371 8.6e-14 PFAM
Pfam:HAD 406 795 3.6e-23 PFAM
Pfam:Cation_ATPase 470 570 1.2e-13 PFAM
Pfam:PhoLip_ATPase_C 812 1064 8.4e-82 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141443
AA Change: R26*
SMART Domains Protein: ENSMUSP00000121630
Gene: ENSMUSG00000037685
AA Change: R26*

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 51 106 9.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200955
SMART Domains Protein: ENSMUSP00000144465
Gene: ENSMUSG00000037685

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 101 7.5e-25 PFAM
Pfam:E1-E2_ATPase 106 371 3.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The P-type adenosinetriphosphatases (P-type ATPases) are a family of proteins which use the free energy of ATP hydrolysis to drive uphill transport of ions across membranes. Several subfamilies of P-type ATPases have been identified. One subfamily catalyzes transport of heavy metal ions. Another subfamily transports non-heavy metal ions (NMHI). The protein encoded by this gene is a member of the third subfamily of P-type ATPases and acts to transport amphipaths, such as phosphatidylserine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable, fertile and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,877,998 S146N possibly damaging Het
Acr T C 15: 89,574,393 S426P possibly damaging Het
Arhgap8 C A 15: 84,757,058 P175Q possibly damaging Het
Arl6ip1 A T 7: 118,126,510 I59N probably damaging Het
Atp2b4 A T 1: 133,701,641 *81K probably null Het
Atp8b4 T A 2: 126,389,342 Q453L probably benign Het
B4galt4 A G 16: 38,754,066 E134G probably damaging Het
Bcl9 G A 3: 97,205,893 T1082I probably damaging Het
Catsperg2 A G 7: 29,709,826 F617L probably benign Het
Ccdc15 T C 9: 37,277,427 N800S probably benign Het
Cd300ld T C 11: 114,987,422 D88G probably benign Het
Ceacam2 A T 7: 25,530,533 V216E probably benign Het
Cecr2 T A 6: 120,761,714 M356K Het
Cenpm T C 15: 82,244,679 M1V probably null Het
Ces2e A G 8: 104,931,906 E401G probably benign Het
Cib3 C A 8: 72,207,197 L65F probably damaging Het
Clip4 C G 17: 71,789,968 T29R probably benign Het
Cnot7 A G 8: 40,500,833 I131T probably damaging Het
Cntn5 A T 9: 9,673,410 probably null Het
Col11a1 A C 3: 114,123,760 H732P unknown Het
Coq4 A T 2: 29,795,408 T145S possibly damaging Het
Cwf19l1 T C 19: 44,110,550 D527G probably benign Het
Cyp3a25 T C 5: 145,986,925 I303V probably damaging Het
Dab2 C T 15: 6,429,918 T437I possibly damaging Het
Dlc1 A G 8: 36,584,655 S190P probably benign Het
Dnah6 G A 6: 73,027,440 L3847F probably damaging Het
Dnmbp T C 19: 43,889,399 E411G probably benign Het
Dpp8 T C 9: 65,037,235 Y95H probably damaging Het
Emb T A 13: 117,272,054 D310E possibly damaging Het
Eml4 C A 17: 83,425,337 Q140K probably benign Het
Epb41l3 T C 17: 69,210,276 S100P probably damaging Het
Fat4 A T 3: 38,981,114 T2972S probably benign Het
Fignl2 T C 15: 101,053,198 E401G unknown Het
Fryl T A 5: 73,191,762 D19V unknown Het
Gck C T 11: 5,902,040 G16R Het
Gm3371 T C 14: 44,410,688 M1V probably null Het
Hlcs T A 16: 94,133,017 K661* probably null Het
Il17re C G 6: 113,466,387 P363A probably damaging Het
Kif24 C T 4: 41,423,601 E217K possibly damaging Het
Klhdc7b T C 15: 89,388,704 I605T probably damaging Het
Krt31 T C 11: 100,049,520 T170A probably damaging Het
Lgals3bp T C 11: 118,396,843 D126G probably benign Het
Lig1 T A 7: 13,301,418 F601Y possibly damaging Het
Lrp6 A G 6: 134,507,508 I384T probably damaging Het
Mfap5 A T 6: 122,526,034 T102S probably benign Het
Mfsd6 A G 1: 52,663,287 F600S possibly damaging Het
Nlrp4a G A 7: 26,450,179 E404K probably damaging Het
Nme3 T C 17: 24,896,548 L12P probably damaging Het
Nxpe5 A T 5: 138,251,231 T428S probably benign Het
Olfr1228 T C 2: 89,249,086 T191A probably benign Het
Olfr385 G A 11: 73,588,976 T254I possibly damaging Het
Psmc6 T C 14: 45,334,918 Y110H probably benign Het
Pthlh T A 6: 147,257,155 R102S possibly damaging Het
Ric8b G T 10: 84,947,872 S198I probably damaging Het
Rrp7a C A 15: 83,117,670 R212S possibly damaging Het
Rubcnl T C 14: 75,042,352 Y392H probably benign Het
Sag G A 1: 87,844,916 V369I probably benign Het
Sar1b A G 11: 51,789,267 E140G probably benign Het
Sema3d T A 5: 12,577,816 M658K unknown Het
Skor2 C T 18: 76,860,905 S774F possibly damaging Het
Slc1a6 G T 10: 78,814,431 R501L probably damaging Het
Spata31d1b A G 13: 59,716,654 M539V probably benign Het
Spocd1 T C 4: 129,929,809 L133P Het
Sptlc1 A T 13: 53,367,932 N96K possibly damaging Het
Stox1 A T 10: 62,666,167 S205T probably damaging Het
Tec T C 5: 72,760,350 M509V probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Ttc34 T A 4: 154,856,359 L499Q probably damaging Het
Uqcc1 A G 2: 155,909,389 C120R probably damaging Het
Usp39 C T 6: 72,345,013 S46N possibly damaging Het
Zbtb5 T C 4: 44,994,724 E220G probably benign Het
Zfp287 A T 11: 62,713,875 C735* probably null Het
Other mutations in Atp8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Atp8a1 APN 5 67749143 missense probably benign 0.20
IGL00778:Atp8a1 APN 5 67659903 missense possibly damaging 0.58
IGL01068:Atp8a1 APN 5 67667337 missense probably benign 0.02
IGL01152:Atp8a1 APN 5 67847206 missense probably damaging 0.99
IGL01572:Atp8a1 APN 5 67667651 missense probably benign
IGL01608:Atp8a1 APN 5 67813136 nonsense probably null
IGL02171:Atp8a1 APN 5 67738465 missense probably damaging 1.00
IGL02330:Atp8a1 APN 5 67813177 missense probably damaging 0.98
IGL02381:Atp8a1 APN 5 67705995 missense probably benign
IGL02420:Atp8a1 APN 5 67682783 missense probably damaging 1.00
IGL02440:Atp8a1 APN 5 67667434 splice site probably benign
IGL02598:Atp8a1 APN 5 67682756 critical splice donor site probably null
IGL03259:Atp8a1 APN 5 67624006 splice site probably null
IGL03336:Atp8a1 APN 5 67729807 nonsense probably null
IGL03380:Atp8a1 APN 5 67732186 missense probably benign 0.25
PIT4131001:Atp8a1 UTSW 5 67622602 nonsense probably null
PIT4445001:Atp8a1 UTSW 5 67622660 missense
R0208:Atp8a1 UTSW 5 67774721 critical splice donor site probably null
R0276:Atp8a1 UTSW 5 67786673 splice site probably benign
R0279:Atp8a1 UTSW 5 67813092 splice site probably null
R0329:Atp8a1 UTSW 5 67812073 splice site probably benign
R0603:Atp8a1 UTSW 5 67756696 critical splice acceptor site probably null
R0715:Atp8a1 UTSW 5 67774725 missense probably benign 0.00
R0763:Atp8a1 UTSW 5 67659883 missense probably benign
R1296:Atp8a1 UTSW 5 67622706 splice site probably benign
R1631:Atp8a1 UTSW 5 67749052 splice site probably null
R1764:Atp8a1 UTSW 5 67631567 missense probably benign 0.14
R1771:Atp8a1 UTSW 5 67647731 missense probably damaging 1.00
R1885:Atp8a1 UTSW 5 67747318 missense possibly damaging 0.82
R1897:Atp8a1 UTSW 5 67738429 missense probably damaging 1.00
R1968:Atp8a1 UTSW 5 67667657 missense probably benign 0.05
R2965:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R2966:Atp8a1 UTSW 5 67647706 missense probably benign 0.28
R4247:Atp8a1 UTSW 5 67667574 missense probably damaging 1.00
R4353:Atp8a1 UTSW 5 67769108 missense probably damaging 1.00
R4400:Atp8a1 UTSW 5 67764878 missense probably benign 0.13
R4426:Atp8a1 UTSW 5 67774828 missense probably benign 0.22
R4523:Atp8a1 UTSW 5 67667600 missense probably benign 0.00
R4576:Atp8a1 UTSW 5 67815815 intron probably benign
R4622:Atp8a1 UTSW 5 67682713 intron probably benign
R4639:Atp8a1 UTSW 5 67655974 missense probably benign 0.36
R4664:Atp8a1 UTSW 5 67762586 missense possibly damaging 0.92
R4732:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R4733:Atp8a1 UTSW 5 67813120 missense probably benign 0.07
R5071:Atp8a1 UTSW 5 67815723 missense probably benign 0.29
R5267:Atp8a1 UTSW 5 67762544 missense probably damaging 1.00
R5314:Atp8a1 UTSW 5 67705905 critical splice donor site probably null
R5424:Atp8a1 UTSW 5 67812100 missense probably damaging 1.00
R5588:Atp8a1 UTSW 5 67814684 missense probably damaging 1.00
R5698:Atp8a1 UTSW 5 67767153 missense probably benign 0.14
R5815:Atp8a1 UTSW 5 67749071 missense probably benign 0.00
R5977:Atp8a1 UTSW 5 67747285 missense possibly damaging 0.94
R6285:Atp8a1 UTSW 5 67667607 missense possibly damaging 0.68
R6341:Atp8a1 UTSW 5 67682927 missense possibly damaging 0.88
R6736:Atp8a1 UTSW 5 67667617 missense probably damaging 1.00
R6746:Atp8a1 UTSW 5 67751049 missense probably benign 0.00
R6887:Atp8a1 UTSW 5 67738451 missense probably benign 0.21
R6946:Atp8a1 UTSW 5 67622625 missense possibly damaging 0.50
R6970:Atp8a1 UTSW 5 67738462 missense probably damaging 1.00
R7035:Atp8a1 UTSW 5 67781030 missense probably benign 0.00
R7218:Atp8a1 UTSW 5 67702981 missense
R7278:Atp8a1 UTSW 5 67624037 missense
R7530:Atp8a1 UTSW 5 67745628 missense
R7594:Atp8a1 UTSW 5 67651592 missense
R7722:Atp8a1 UTSW 5 67622698 critical splice acceptor site probably null
R8152:Atp8a1 UTSW 5 67762582 missense
X0019:Atp8a1 UTSW 5 67749141 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTGGGAAGTCCATTTGTTTCC -3'
(R):5'- TACCATTTGTCACTAGCGGC -3'

Sequencing Primer
(F):5'- GGGAAGTCCATTTGTTTCCTTTCC -3'
(R):5'- CACTAGCGGCTGGTTATCATTAG -3'
Posted On2019-10-17