Incidental Mutation 'R7548:Cyp3a25'
ID584303
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R7548 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145986925 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 303 (I303V)
Ref Sequence ENSEMBL: ENSMUSP00000065585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably damaging
Transcript: ENSMUST00000068317
AA Change: I303V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: I303V

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Meta Mutation Damage Score 0.3353 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,877,998 S146N possibly damaging Het
Acr T C 15: 89,574,393 S426P possibly damaging Het
Arhgap8 C A 15: 84,757,058 P175Q possibly damaging Het
Arl6ip1 A T 7: 118,126,510 I59N probably damaging Het
Atp2b4 A T 1: 133,701,641 *81K probably null Het
Atp8a1 T A 5: 67,815,728 R26* probably null Het
Atp8b4 T A 2: 126,389,342 Q453L probably benign Het
B4galt4 A G 16: 38,754,066 E134G probably damaging Het
Bcl9 G A 3: 97,205,893 T1082I probably damaging Het
Catsperg2 A G 7: 29,709,826 F617L probably benign Het
Ccdc15 T C 9: 37,277,427 N800S probably benign Het
Cd300ld T C 11: 114,987,422 D88G probably benign Het
Ceacam2 A T 7: 25,530,533 V216E probably benign Het
Cecr2 T A 6: 120,761,714 M356K Het
Cenpm T C 15: 82,244,679 M1V probably null Het
Ces2e A G 8: 104,931,906 E401G probably benign Het
Cib3 C A 8: 72,207,197 L65F probably damaging Het
Clip4 C G 17: 71,789,968 T29R probably benign Het
Cnot7 A G 8: 40,500,833 I131T probably damaging Het
Cntn5 A T 9: 9,673,410 probably null Het
Col11a1 A C 3: 114,123,760 H732P unknown Het
Coq4 A T 2: 29,795,408 T145S possibly damaging Het
Cwf19l1 T C 19: 44,110,550 D527G probably benign Het
Dab2 C T 15: 6,429,918 T437I possibly damaging Het
Dlc1 A G 8: 36,584,655 S190P probably benign Het
Dnah6 G A 6: 73,027,440 L3847F probably damaging Het
Dnmbp T C 19: 43,889,399 E411G probably benign Het
Dpp8 T C 9: 65,037,235 Y95H probably damaging Het
Emb T A 13: 117,272,054 D310E possibly damaging Het
Eml4 C A 17: 83,425,337 Q140K probably benign Het
Epb41l3 T C 17: 69,210,276 S100P probably damaging Het
Fat4 A T 3: 38,981,114 T2972S probably benign Het
Fignl2 T C 15: 101,053,198 E401G unknown Het
Fryl T A 5: 73,191,762 D19V unknown Het
Gck C T 11: 5,902,040 G16R Het
Gm3371 T C 14: 44,410,688 M1V probably null Het
Hlcs T A 16: 94,133,017 K661* probably null Het
Il17re C G 6: 113,466,387 P363A probably damaging Het
Kif24 C T 4: 41,423,601 E217K possibly damaging Het
Klhdc7b T C 15: 89,388,704 I605T probably damaging Het
Krt31 T C 11: 100,049,520 T170A probably damaging Het
Lgals3bp T C 11: 118,396,843 D126G probably benign Het
Lig1 T A 7: 13,301,418 F601Y possibly damaging Het
Lrp6 A G 6: 134,507,508 I384T probably damaging Het
Mfap5 A T 6: 122,526,034 T102S probably benign Het
Mfsd6 A G 1: 52,663,287 F600S possibly damaging Het
Nlrp4a G A 7: 26,450,179 E404K probably damaging Het
Nme3 T C 17: 24,896,548 L12P probably damaging Het
Nxpe5 A T 5: 138,251,231 T428S probably benign Het
Olfr1228 T C 2: 89,249,086 T191A probably benign Het
Olfr385 G A 11: 73,588,976 T254I possibly damaging Het
Psmc6 T C 14: 45,334,918 Y110H probably benign Het
Pthlh T A 6: 147,257,155 R102S possibly damaging Het
Ric8b G T 10: 84,947,872 S198I probably damaging Het
Rrp7a C A 15: 83,117,670 R212S possibly damaging Het
Rubcnl T C 14: 75,042,352 Y392H probably benign Het
Sag G A 1: 87,844,916 V369I probably benign Het
Sar1b A G 11: 51,789,267 E140G probably benign Het
Sema3d T A 5: 12,577,816 M658K unknown Het
Skor2 C T 18: 76,860,905 S774F possibly damaging Het
Slc1a6 G T 10: 78,814,431 R501L probably damaging Het
Spata31d1b A G 13: 59,716,654 M539V probably benign Het
Spocd1 T C 4: 129,929,809 L133P Het
Sptlc1 A T 13: 53,367,932 N96K possibly damaging Het
Stox1 A T 10: 62,666,167 S205T probably damaging Het
Tec T C 5: 72,760,350 M509V probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Ttc34 T A 4: 154,856,359 L499Q probably damaging Het
Uqcc1 A G 2: 155,909,389 C120R probably damaging Het
Usp39 C T 6: 72,345,013 S46N possibly damaging Het
Zbtb5 T C 4: 44,994,724 E220G probably benign Het
Zfp287 A T 11: 62,713,875 C735* probably null Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R5787:Cyp3a25 UTSW 5 145998503 missense probably benign 0.14
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
R7055:Cyp3a25 UTSW 5 145992991 missense probably benign 0.00
R7140:Cyp3a25 UTSW 5 146003045 missense probably benign
R7189:Cyp3a25 UTSW 5 146003060 missense probably benign 0.37
R7201:Cyp3a25 UTSW 5 145991447 missense probably benign 0.22
R7201:Cyp3a25 UTSW 5 146003058 missense probably benign 0.00
R7332:Cyp3a25 UTSW 5 145993007 missense probably damaging 1.00
R7404:Cyp3a25 UTSW 5 145986825 missense probably damaging 1.00
R7607:Cyp3a25 UTSW 5 145984981 missense possibly damaging 0.87
R8022:Cyp3a25 UTSW 5 145977668 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TAACTGTCCAGACACGTGGG -3'
(R):5'- TCCCAGTTACTGTGAACTGCC -3'

Sequencing Primer
(F):5'- GACATGTGCTGTTTGGAAAAACC -3'
(R):5'- AGTTACTGTGAACTGCCTTTTTCTG -3'
Posted On2019-10-17