Incidental Mutation 'R7548:Usp39'
ID584304
Institutional Source Beutler Lab
Gene Symbol Usp39
Ensembl Gene ENSMUSG00000056305
Gene Nameubiquitin specific peptidase 39
SynonymsSAD1, CGI-21, D6Wsu157e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7548 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location72318678-72345184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72345013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 46 (S46N)
Ref Sequence ENSEMBL: ENSMUSP00000064515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345] [ENSMUST00000077783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070345
AA Change: S46N

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305
AA Change: S46N

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077783
SMART Domains Protein: ENSMUSP00000076957
Gene: ENSMUSG00000058706

DomainStartEndE-ValueType
Pfam:UPF0561 1 126 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206262
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,877,998 S146N possibly damaging Het
Acr T C 15: 89,574,393 S426P possibly damaging Het
Arhgap8 C A 15: 84,757,058 P175Q possibly damaging Het
Arl6ip1 A T 7: 118,126,510 I59N probably damaging Het
Atp2b4 A T 1: 133,701,641 *81K probably null Het
Atp8a1 T A 5: 67,815,728 R26* probably null Het
Atp8b4 T A 2: 126,389,342 Q453L probably benign Het
B4galt4 A G 16: 38,754,066 E134G probably damaging Het
Bcl9 G A 3: 97,205,893 T1082I probably damaging Het
Catsperg2 A G 7: 29,709,826 F617L probably benign Het
Ccdc15 T C 9: 37,277,427 N800S probably benign Het
Cd300ld T C 11: 114,987,422 D88G probably benign Het
Ceacam2 A T 7: 25,530,533 V216E probably benign Het
Cecr2 T A 6: 120,761,714 M356K Het
Cenpm T C 15: 82,244,679 M1V probably null Het
Ces2e A G 8: 104,931,906 E401G probably benign Het
Cib3 C A 8: 72,207,197 L65F probably damaging Het
Clip4 C G 17: 71,789,968 T29R probably benign Het
Cnot7 A G 8: 40,500,833 I131T probably damaging Het
Cntn5 A T 9: 9,673,410 probably null Het
Col11a1 A C 3: 114,123,760 H732P unknown Het
Coq4 A T 2: 29,795,408 T145S possibly damaging Het
Cwf19l1 T C 19: 44,110,550 D527G probably benign Het
Cyp3a25 T C 5: 145,986,925 I303V probably damaging Het
Dab2 C T 15: 6,429,918 T437I possibly damaging Het
Dlc1 A G 8: 36,584,655 S190P probably benign Het
Dnah6 G A 6: 73,027,440 L3847F probably damaging Het
Dnmbp T C 19: 43,889,399 E411G probably benign Het
Dpp8 T C 9: 65,037,235 Y95H probably damaging Het
Emb T A 13: 117,272,054 D310E possibly damaging Het
Eml4 C A 17: 83,425,337 Q140K probably benign Het
Epb41l3 T C 17: 69,210,276 S100P probably damaging Het
Fat4 A T 3: 38,981,114 T2972S probably benign Het
Fignl2 T C 15: 101,053,198 E401G unknown Het
Fryl T A 5: 73,191,762 D19V unknown Het
Gck C T 11: 5,902,040 G16R Het
Gm3371 T C 14: 44,410,688 M1V probably null Het
Hlcs T A 16: 94,133,017 K661* probably null Het
Il17re C G 6: 113,466,387 P363A probably damaging Het
Kif24 C T 4: 41,423,601 E217K possibly damaging Het
Klhdc7b T C 15: 89,388,704 I605T probably damaging Het
Krt31 T C 11: 100,049,520 T170A probably damaging Het
Lgals3bp T C 11: 118,396,843 D126G probably benign Het
Lig1 T A 7: 13,301,418 F601Y possibly damaging Het
Lrp6 A G 6: 134,507,508 I384T probably damaging Het
Mfap5 A T 6: 122,526,034 T102S probably benign Het
Mfsd6 A G 1: 52,663,287 F600S possibly damaging Het
Nlrp4a G A 7: 26,450,179 E404K probably damaging Het
Nme3 T C 17: 24,896,548 L12P probably damaging Het
Nxpe5 A T 5: 138,251,231 T428S probably benign Het
Olfr1228 T C 2: 89,249,086 T191A probably benign Het
Olfr385 G A 11: 73,588,976 T254I possibly damaging Het
Psmc6 T C 14: 45,334,918 Y110H probably benign Het
Pthlh T A 6: 147,257,155 R102S possibly damaging Het
Ric8b G T 10: 84,947,872 S198I probably damaging Het
Rrp7a C A 15: 83,117,670 R212S possibly damaging Het
Rubcnl T C 14: 75,042,352 Y392H probably benign Het
Sag G A 1: 87,844,916 V369I probably benign Het
Sar1b A G 11: 51,789,267 E140G probably benign Het
Sema3d T A 5: 12,577,816 M658K unknown Het
Skor2 C T 18: 76,860,905 S774F possibly damaging Het
Slc1a6 G T 10: 78,814,431 R501L probably damaging Het
Spata31d1b A G 13: 59,716,654 M539V probably benign Het
Spocd1 T C 4: 129,929,809 L133P Het
Sptlc1 A T 13: 53,367,932 N96K possibly damaging Het
Stox1 A T 10: 62,666,167 S205T probably damaging Het
Tec T C 5: 72,760,350 M509V probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Ttc34 T A 4: 154,856,359 L499Q probably damaging Het
Uqcc1 A G 2: 155,909,389 C120R probably damaging Het
Zbtb5 T C 4: 44,994,724 E220G probably benign Het
Zfp287 A T 11: 62,713,875 C735* probably null Het
Other mutations in Usp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Usp39 APN 6 72328624 missense probably damaging 0.99
IGL01065:Usp39 APN 6 72339975 missense probably damaging 1.00
IGL01669:Usp39 APN 6 72338493 missense probably damaging 0.99
IGL03089:Usp39 APN 6 72328639 missense probably damaging 1.00
IGL03397:Usp39 APN 6 72336313 missense possibly damaging 0.53
R0561:Usp39 UTSW 6 72336385 missense probably damaging 1.00
R3236:Usp39 UTSW 6 72338389 splice site probably benign
R3552:Usp39 UTSW 6 72337832 missense possibly damaging 0.63
R4010:Usp39 UTSW 6 72336485 missense probably benign 0.44
R4854:Usp39 UTSW 6 72325682 missense probably benign 0.29
R5502:Usp39 UTSW 6 72328687 missense probably benign
R6868:Usp39 UTSW 6 72337751 missense possibly damaging 0.93
R6887:Usp39 UTSW 6 72333157 missense probably damaging 1.00
R7313:Usp39 UTSW 6 72336430 missense probably benign 0.00
R7429:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7430:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7431:Usp39 UTSW 6 72336268 missense possibly damaging 0.66
R7544:Usp39 UTSW 6 72342908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAAGTTCCTGAGACCCGTC -3'
(R):5'- ACTTCTGATTGGCTGCTTGC -3'

Sequencing Primer
(F):5'- GACCCGTCTTTAAAAATATAGGAGG -3'
(R):5'- CTTGCTGCCCGTGCTCG -3'
Posted On2019-10-17