Incidental Mutation 'R7548:Nlrp4a'
ID584313
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R7548 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26450179 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 404 (E404K)
Ref Sequence ENSEMBL: ENSMUSP00000066841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably damaging
Transcript: ENSMUST00000068767
AA Change: E404K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: E404K

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119386
AA Change: E404K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: E404K

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146907
AA Change: E404K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,877,998 S146N possibly damaging Het
Acr T C 15: 89,574,393 S426P possibly damaging Het
Arhgap8 C A 15: 84,757,058 P175Q possibly damaging Het
Arl6ip1 A T 7: 118,126,510 I59N probably damaging Het
Atp2b4 A T 1: 133,701,641 *81K probably null Het
Atp8a1 T A 5: 67,815,728 R26* probably null Het
Atp8b4 T A 2: 126,389,342 Q453L probably benign Het
B4galt4 A G 16: 38,754,066 E134G probably damaging Het
Bcl9 G A 3: 97,205,893 T1082I probably damaging Het
Catsperg2 A G 7: 29,709,826 F617L probably benign Het
Ccdc15 T C 9: 37,277,427 N800S probably benign Het
Cd300ld T C 11: 114,987,422 D88G probably benign Het
Ceacam2 A T 7: 25,530,533 V216E probably benign Het
Cecr2 T A 6: 120,761,714 M356K Het
Cenpm T C 15: 82,244,679 M1V probably null Het
Ces2e A G 8: 104,931,906 E401G probably benign Het
Cib3 C A 8: 72,207,197 L65F probably damaging Het
Clip4 C G 17: 71,789,968 T29R probably benign Het
Cnot7 A G 8: 40,500,833 I131T probably damaging Het
Cntn5 A T 9: 9,673,410 probably null Het
Col11a1 A C 3: 114,123,760 H732P unknown Het
Coq4 A T 2: 29,795,408 T145S possibly damaging Het
Cwf19l1 T C 19: 44,110,550 D527G probably benign Het
Cyp3a25 T C 5: 145,986,925 I303V probably damaging Het
Dab2 C T 15: 6,429,918 T437I possibly damaging Het
Dlc1 A G 8: 36,584,655 S190P probably benign Het
Dnah6 G A 6: 73,027,440 L3847F probably damaging Het
Dnmbp T C 19: 43,889,399 E411G probably benign Het
Dpp8 T C 9: 65,037,235 Y95H probably damaging Het
Emb T A 13: 117,272,054 D310E possibly damaging Het
Eml4 C A 17: 83,425,337 Q140K probably benign Het
Epb41l3 T C 17: 69,210,276 S100P probably damaging Het
Fat4 A T 3: 38,981,114 T2972S probably benign Het
Fignl2 T C 15: 101,053,198 E401G unknown Het
Fryl T A 5: 73,191,762 D19V unknown Het
Gck C T 11: 5,902,040 G16R Het
Gm3371 T C 14: 44,410,688 M1V probably null Het
Hlcs T A 16: 94,133,017 K661* probably null Het
Il17re C G 6: 113,466,387 P363A probably damaging Het
Kif24 C T 4: 41,423,601 E217K possibly damaging Het
Klhdc7b T C 15: 89,388,704 I605T probably damaging Het
Krt31 T C 11: 100,049,520 T170A probably damaging Het
Lgals3bp T C 11: 118,396,843 D126G probably benign Het
Lig1 T A 7: 13,301,418 F601Y possibly damaging Het
Lrp6 A G 6: 134,507,508 I384T probably damaging Het
Mfap5 A T 6: 122,526,034 T102S probably benign Het
Mfsd6 A G 1: 52,663,287 F600S possibly damaging Het
Nme3 T C 17: 24,896,548 L12P probably damaging Het
Nxpe5 A T 5: 138,251,231 T428S probably benign Het
Olfr1228 T C 2: 89,249,086 T191A probably benign Het
Olfr385 G A 11: 73,588,976 T254I possibly damaging Het
Psmc6 T C 14: 45,334,918 Y110H probably benign Het
Pthlh T A 6: 147,257,155 R102S possibly damaging Het
Ric8b G T 10: 84,947,872 S198I probably damaging Het
Rrp7a C A 15: 83,117,670 R212S possibly damaging Het
Rubcnl T C 14: 75,042,352 Y392H probably benign Het
Sag G A 1: 87,844,916 V369I probably benign Het
Sar1b A G 11: 51,789,267 E140G probably benign Het
Sema3d T A 5: 12,577,816 M658K unknown Het
Skor2 C T 18: 76,860,905 S774F possibly damaging Het
Slc1a6 G T 10: 78,814,431 R501L probably damaging Het
Spata31d1b A G 13: 59,716,654 M539V probably benign Het
Spocd1 T C 4: 129,929,809 L133P Het
Sptlc1 A T 13: 53,367,932 N96K possibly damaging Het
Stox1 A T 10: 62,666,167 S205T probably damaging Het
Tec T C 5: 72,760,350 M509V probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Ttc34 T A 4: 154,856,359 L499Q probably damaging Het
Uqcc1 A G 2: 155,909,389 C120R probably damaging Het
Usp39 C T 6: 72,345,013 S46N possibly damaging Het
Zbtb5 T C 4: 44,994,724 E220G probably benign Het
Zfp287 A T 11: 62,713,875 C735* probably null Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26450794 missense probably benign
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAATGAGCAGCTGTTCACTG -3'
(R):5'- AAGATAGCTGCACAGACCTC -3'

Sequencing Primer
(F):5'- AATGAGCAGCTGTTCACTGTATGTC -3'
(R):5'- CCTCCTGAACAGATGGATGG -3'
Posted On2019-10-17