Incidental Mutation 'R7548:Acr'
ID584344
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7548 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89574393 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 426 (S426P)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023295
AA Change: S426P

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: S426P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230538
Predicted Effect probably benign
Transcript: ENSMUST00000230978
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,877,998 S146N possibly damaging Het
Arhgap8 C A 15: 84,757,058 P175Q possibly damaging Het
Arl6ip1 A T 7: 118,126,510 I59N probably damaging Het
Atp2b4 A T 1: 133,701,641 *81K probably null Het
Atp8a1 T A 5: 67,815,728 R26* probably null Het
Atp8b4 T A 2: 126,389,342 Q453L probably benign Het
B4galt4 A G 16: 38,754,066 E134G probably damaging Het
Bcl9 G A 3: 97,205,893 T1082I probably damaging Het
Catsperg2 A G 7: 29,709,826 F617L probably benign Het
Ccdc15 T C 9: 37,277,427 N800S probably benign Het
Cd300ld T C 11: 114,987,422 D88G probably benign Het
Ceacam2 A T 7: 25,530,533 V216E probably benign Het
Cecr2 T A 6: 120,761,714 M356K Het
Cenpm T C 15: 82,244,679 M1V probably null Het
Ces2e A G 8: 104,931,906 E401G probably benign Het
Cib3 C A 8: 72,207,197 L65F probably damaging Het
Clip4 C G 17: 71,789,968 T29R probably benign Het
Cnot7 A G 8: 40,500,833 I131T probably damaging Het
Cntn5 A T 9: 9,673,410 probably null Het
Col11a1 A C 3: 114,123,760 H732P unknown Het
Coq4 A T 2: 29,795,408 T145S possibly damaging Het
Cwf19l1 T C 19: 44,110,550 D527G probably benign Het
Cyp3a25 T C 5: 145,986,925 I303V probably damaging Het
Dab2 C T 15: 6,429,918 T437I possibly damaging Het
Dlc1 A G 8: 36,584,655 S190P probably benign Het
Dnah6 G A 6: 73,027,440 L3847F probably damaging Het
Dnmbp T C 19: 43,889,399 E411G probably benign Het
Dpp8 T C 9: 65,037,235 Y95H probably damaging Het
Emb T A 13: 117,272,054 D310E possibly damaging Het
Eml4 C A 17: 83,425,337 Q140K probably benign Het
Epb41l3 T C 17: 69,210,276 S100P probably damaging Het
Fat4 A T 3: 38,981,114 T2972S probably benign Het
Fignl2 T C 15: 101,053,198 E401G unknown Het
Fryl T A 5: 73,191,762 D19V unknown Het
Gck C T 11: 5,902,040 G16R Het
Gm3371 T C 14: 44,410,688 M1V probably null Het
Hlcs T A 16: 94,133,017 K661* probably null Het
Il17re C G 6: 113,466,387 P363A probably damaging Het
Kif24 C T 4: 41,423,601 E217K possibly damaging Het
Klhdc7b T C 15: 89,388,704 I605T probably damaging Het
Krt31 T C 11: 100,049,520 T170A probably damaging Het
Lgals3bp T C 11: 118,396,843 D126G probably benign Het
Lig1 T A 7: 13,301,418 F601Y possibly damaging Het
Lrp6 A G 6: 134,507,508 I384T probably damaging Het
Mfap5 A T 6: 122,526,034 T102S probably benign Het
Mfsd6 A G 1: 52,663,287 F600S possibly damaging Het
Nlrp4a G A 7: 26,450,179 E404K probably damaging Het
Nme3 T C 17: 24,896,548 L12P probably damaging Het
Nxpe5 A T 5: 138,251,231 T428S probably benign Het
Olfr1228 T C 2: 89,249,086 T191A probably benign Het
Olfr385 G A 11: 73,588,976 T254I possibly damaging Het
Psmc6 T C 14: 45,334,918 Y110H probably benign Het
Pthlh T A 6: 147,257,155 R102S possibly damaging Het
Ric8b G T 10: 84,947,872 S198I probably damaging Het
Rrp7a C A 15: 83,117,670 R212S possibly damaging Het
Rubcnl T C 14: 75,042,352 Y392H probably benign Het
Sag G A 1: 87,844,916 V369I probably benign Het
Sar1b A G 11: 51,789,267 E140G probably benign Het
Sema3d T A 5: 12,577,816 M658K unknown Het
Skor2 C T 18: 76,860,905 S774F possibly damaging Het
Slc1a6 G T 10: 78,814,431 R501L probably damaging Het
Spata31d1b A G 13: 59,716,654 M539V probably benign Het
Spocd1 T C 4: 129,929,809 L133P Het
Sptlc1 A T 13: 53,367,932 N96K possibly damaging Het
Stox1 A T 10: 62,666,167 S205T probably damaging Het
Tec T C 5: 72,760,350 M509V probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Ttc34 T A 4: 154,856,359 L499Q probably damaging Het
Uqcc1 A G 2: 155,909,389 C120R probably damaging Het
Usp39 C T 6: 72,345,013 S46N possibly damaging Het
Zbtb5 T C 4: 44,994,724 E220G probably benign Het
Zfp287 A T 11: 62,713,875 C735* probably null Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0398:Acr UTSW 15 89573941 missense probably damaging 1.00
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R1792:Acr UTSW 15 89573143 missense probably benign 0.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5531:Acr UTSW 15 89573943 missense probably damaging 1.00
R5577:Acr UTSW 15 89574238 missense probably benign 0.01
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
R7484:Acr UTSW 15 89573224 missense probably damaging 0.99
R8001:Acr UTSW 15 89573962 missense probably damaging 1.00
Z1177:Acr UTSW 15 89569879 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTACCTGCGACCACTACGG -3'
(R):5'- TCCATTTTATTGGAGCTGAGCAGG -3'

Sequencing Primer
(F):5'- GGCCGTCTTCGACCCAAAC -3'
(R):5'- CTGAGCAGGGAGGATGTAAATTTG -3'
Posted On2019-10-17