Incidental Mutation 'R7549:Kmt2c'
ID 584376
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, HALR, E330008K23Rik
MMRRC Submission 045620-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7549 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 25476796-25703781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25619968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 102 (K102E)
Ref Sequence ENSEMBL: ENSMUSP00000133304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073] [ENSMUST00000173174]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045291
AA Change: K102E

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: K102E

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173073
AA Change: K102E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: K102E

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173174
AA Change: K102E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133304
Gene: ENSMUSG00000038056
AA Change: K102E

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 775 788 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adam1b A G 5: 121,639,981 (GRCm39) C355R probably damaging Het
Adamtsl3 T C 7: 82,223,117 (GRCm39) L966P probably damaging Het
Aldh18a1 A G 19: 40,553,291 (GRCm39) C486R probably damaging Het
Aqp11 C A 7: 97,387,284 (GRCm39) probably benign Het
Arhgap28 A G 17: 68,178,961 (GRCm39) L350P probably damaging Het
Art3 A G 5: 92,551,514 (GRCm39) Q291R probably benign Het
Asb15 A G 6: 24,559,029 (GRCm39) probably null Het
Bmp8b T C 4: 122,999,448 (GRCm39) I102T possibly damaging Het
Bsn T C 9: 107,992,014 (GRCm39) D1246G probably benign Het
Cass4 G A 2: 172,268,718 (GRCm39) G267S probably benign Het
Cass4 G T 2: 172,268,719 (GRCm39) G267V probably benign Het
Ccr7 T C 11: 99,036,727 (GRCm39) Y65C probably damaging Het
Clstn2 A C 9: 97,464,597 (GRCm39) I186S probably benign Het
Cyp2r1 A G 7: 114,153,879 (GRCm39) I105T possibly damaging Het
Efr3a T A 15: 65,687,262 (GRCm39) probably null Het
Erg A C 16: 95,170,179 (GRCm39) probably null Het
Eya4 A T 10: 22,987,557 (GRCm39) V524E probably damaging Het
Farp1 C A 14: 121,472,589 (GRCm39) N241K possibly damaging Het
Fat1 A T 8: 45,442,031 (GRCm39) Y1111F probably benign Het
Fbn1 T C 2: 125,185,947 (GRCm39) E1607G probably damaging Het
Fbn2 A T 18: 58,153,536 (GRCm39) C2575* probably null Het
Fsip2 A T 2: 82,824,337 (GRCm39) D6690V probably damaging Het
Fzd4 T C 7: 89,056,346 (GRCm39) V131A possibly damaging Het
Gfral T A 9: 76,106,257 (GRCm39) N110I probably benign Het
Glce T C 9: 61,968,275 (GRCm39) D292G probably damaging Het
Gm19410 T A 8: 36,266,500 (GRCm39) I1051K probably benign Het
Gm5773 A T 3: 93,680,323 (GRCm39) probably benign Het
Hcn3 A T 3: 89,057,307 (GRCm39) H430Q probably null Het
Hspa8 T A 9: 40,714,255 (GRCm39) probably null Het
Ifna7 A T 4: 88,734,664 (GRCm39) D67V possibly damaging Het
Kif5c T A 2: 49,591,105 (GRCm39) M319K probably benign Het
Klk7 G T 7: 43,462,197 (GRCm39) probably null Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrp1b C T 2: 40,765,134 (GRCm39) M2897I Het
Lysmd2 T C 9: 75,544,519 (GRCm39) S211P probably damaging Het
Magi1 T G 6: 93,685,095 (GRCm39) E761A probably benign Het
Mbd5 T A 2: 49,141,355 (GRCm39) I106N probably damaging Het
Mdc1 G A 17: 36,159,749 (GRCm39) A669T probably null Het
Mmp1b A G 9: 7,384,753 (GRCm39) I265T probably benign Het
Mmp2 T A 8: 93,563,594 (GRCm39) L356Q probably null Het
Mroh8 A G 2: 157,111,492 (GRCm39) L154P probably benign Het
Muc13 T C 16: 33,619,806 (GRCm39) S185P unknown Het
Nuak1 T A 10: 84,210,403 (GRCm39) I562F probably benign Het
Obscn C A 11: 58,933,664 (GRCm39) probably null Het
Or51t4 T C 7: 102,597,798 (GRCm39) I42T possibly damaging Het
Or5w14 A T 2: 87,542,115 (GRCm39) M45K probably damaging Het
Or9k7 T C 10: 130,046,853 (GRCm39) M49V probably benign Het
Pex3 T C 10: 13,418,414 (GRCm39) M81V probably benign Het
Pex5l T A 3: 33,136,184 (GRCm39) I12F probably benign Het
Phf3 G T 1: 30,870,556 (GRCm39) T164N probably benign Het
Phpt1 G T 2: 25,464,844 (GRCm39) A3E probably benign Het
Pja2 A T 17: 64,616,410 (GRCm39) L162M probably damaging Het
Pkdrej T A 15: 85,703,994 (GRCm39) K647N probably damaging Het
Ppp2r1a T C 17: 21,182,944 (GRCm39) S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 (GRCm39) D473Y probably damaging Het
Prl6a1 A T 13: 27,502,954 (GRCm39) E183D probably damaging Het
Psmd3 C T 11: 98,581,787 (GRCm39) T304M probably benign Het
Ptpn5 C T 7: 46,735,874 (GRCm39) probably null Het
Rassf6 T G 5: 90,754,661 (GRCm39) I206L probably damaging Het
Rif1 A G 2: 51,968,519 (GRCm39) H234R possibly damaging Het
Rint1 T C 5: 24,020,702 (GRCm39) V575A probably benign Het
Ros1 G A 10: 52,021,930 (GRCm39) T639I probably damaging Het
Ryr2 A G 13: 11,752,871 (GRCm39) F1817L probably benign Het
Ska1 T C 18: 74,333,088 (GRCm39) D110G probably benign Het
Slc25a41 G A 17: 57,340,791 (GRCm39) T227I probably damaging Het
Slc6a15 T C 10: 103,224,998 (GRCm39) S29P probably benign Het
Slc8a3 A T 12: 81,361,544 (GRCm39) I425K probably benign Het
Sox8 T A 17: 25,786,935 (GRCm39) Q256L probably damaging Het
Tars3 T C 7: 65,297,341 (GRCm39) V152A probably damaging Het
Tbx10 A T 19: 4,046,651 (GRCm39) T44S probably benign Het
Terb1 T A 8: 105,224,716 (GRCm39) I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,740 (GRCm39) probably null Het
Tgm1 A G 14: 55,943,360 (GRCm39) V527A probably benign Het
Tmed10 G T 12: 85,391,036 (GRCm39) Y167* probably null Het
Tmem165 T G 5: 76,356,415 (GRCm39) S318R possibly damaging Het
Trim9 G T 12: 70,393,715 (GRCm39) S76R probably damaging Het
Tti1 A G 2: 157,849,088 (GRCm39) V717A probably damaging Het
Vmn2r86 T A 10: 130,282,697 (GRCm39) I640F probably damaging Het
Vwf A G 6: 125,603,230 (GRCm39) N860S Het
Xirp2 A G 2: 67,339,241 (GRCm39) K494R possibly damaging Het
Zkscan4 G A 13: 21,668,419 (GRCm39) S319N probably damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25,486,259 (GRCm39) missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25,498,159 (GRCm39) missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25,516,049 (GRCm39) missense probably benign 0.00
IGL00811:Kmt2c APN 5 25,579,531 (GRCm39) missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25,614,169 (GRCm39) missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25,582,159 (GRCm39) missense probably benign 0.08
IGL00959:Kmt2c APN 5 25,481,227 (GRCm39) missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25,507,699 (GRCm39) unclassified probably benign
IGL01146:Kmt2c APN 5 25,513,510 (GRCm39) missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25,489,397 (GRCm39) missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25,614,306 (GRCm39) missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25,557,242 (GRCm39) missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25,534,439 (GRCm39) splice site probably benign
IGL01530:Kmt2c APN 5 25,518,498 (GRCm39) missense probably benign 0.08
IGL01550:Kmt2c APN 5 25,486,274 (GRCm39) missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25,478,664 (GRCm39) makesense probably null
IGL01598:Kmt2c APN 5 25,559,769 (GRCm39) missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25,559,809 (GRCm39) missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25,515,668 (GRCm39) missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25,505,096 (GRCm39) missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25,518,398 (GRCm39) missense probably benign
IGL01784:Kmt2c APN 5 25,518,524 (GRCm39) missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25,495,802 (GRCm39) missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25,515,594 (GRCm39) missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25,600,453 (GRCm39) missense probably benign 0.05
IGL02072:Kmt2c APN 5 25,610,430 (GRCm39) missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25,516,341 (GRCm39) missense probably benign 0.18
IGL02303:Kmt2c APN 5 25,515,155 (GRCm39) missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25,578,018 (GRCm39) missense probably benign
IGL02578:Kmt2c APN 5 25,571,198 (GRCm39) intron probably benign
IGL02811:Kmt2c APN 5 25,520,026 (GRCm39) nonsense probably null
IGL02943:Kmt2c APN 5 25,495,821 (GRCm39) missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25,489,170 (GRCm39) missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25,515,350 (GRCm39) missense probably benign
IGL03076:Kmt2c APN 5 25,504,149 (GRCm39) nonsense probably null
IGL03088:Kmt2c APN 5 25,504,802 (GRCm39) missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25,520,359 (GRCm39) missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25,520,764 (GRCm39) small insertion probably benign
FR4976:Kmt2c UTSW 5 25,520,761 (GRCm39) small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25,520,664 (GRCm39) missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25,520,104 (GRCm39) missense probably benign 0.21
R0313:Kmt2c UTSW 5 25,549,928 (GRCm39) missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25,514,706 (GRCm39) missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25,580,955 (GRCm39) missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25,520,662 (GRCm39) missense probably benign
R0453:Kmt2c UTSW 5 25,559,745 (GRCm39) missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25,504,250 (GRCm39) missense probably benign
R0619:Kmt2c UTSW 5 25,503,914 (GRCm39) missense probably benign 0.21
R0671:Kmt2c UTSW 5 25,609,363 (GRCm39) missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25,500,432 (GRCm39) missense probably benign
R0745:Kmt2c UTSW 5 25,564,696 (GRCm39) splice site probably null
R0760:Kmt2c UTSW 5 25,558,315 (GRCm39) missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25,515,893 (GRCm39) missense probably benign 0.00
R0882:Kmt2c UTSW 5 25,500,605 (GRCm39) missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25,556,268 (GRCm39) splice site probably benign
R0942:Kmt2c UTSW 5 25,520,301 (GRCm39) missense probably benign 0.10
R1110:Kmt2c UTSW 5 25,519,360 (GRCm39) missense probably benign 0.01
R1137:Kmt2c UTSW 5 25,515,981 (GRCm39) missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25,556,151 (GRCm39) missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25,610,452 (GRCm39) missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25,519,513 (GRCm39) missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25,519,876 (GRCm39) missense probably benign 0.01
R1611:Kmt2c UTSW 5 25,564,309 (GRCm39) critical splice donor site probably null
R1617:Kmt2c UTSW 5 25,580,925 (GRCm39) missense probably benign 0.01
R1720:Kmt2c UTSW 5 25,504,182 (GRCm39) missense probably benign 0.05
R1723:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25,495,525 (GRCm39) missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25,577,972 (GRCm39) missense probably benign 0.02
R1809:Kmt2c UTSW 5 25,489,190 (GRCm39) missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25,578,434 (GRCm39) missense probably benign 0.45
R1895:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1946:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1989:Kmt2c UTSW 5 25,703,542 (GRCm39) missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25,534,038 (GRCm39) missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25,490,077 (GRCm39) missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25,557,278 (GRCm39) missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25,559,715 (GRCm39) missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25,514,822 (GRCm39) missense probably benign 0.01
R2186:Kmt2c UTSW 5 25,492,110 (GRCm39) missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25,520,150 (GRCm39) missense probably benign
R2983:Kmt2c UTSW 5 25,520,755 (GRCm39) small deletion probably benign
R3109:Kmt2c UTSW 5 25,480,733 (GRCm39) missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25,504,477 (GRCm39) missense probably benign 0.02
R3738:Kmt2c UTSW 5 25,610,381 (GRCm39) missense probably benign 0.41
R3809:Kmt2c UTSW 5 25,614,136 (GRCm39) missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25,492,711 (GRCm39) missense probably benign
R4107:Kmt2c UTSW 5 25,503,918 (GRCm39) missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25,552,357 (GRCm39) critical splice donor site probably null
R4376:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4377:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4383:Kmt2c UTSW 5 25,556,060 (GRCm39) missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25,519,875 (GRCm39) missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25,515,210 (GRCm39) missense probably benign
R4461:Kmt2c UTSW 5 25,504,874 (GRCm39) missense probably benign 0.00
R4519:Kmt2c UTSW 5 25,568,475 (GRCm39) missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25,505,172 (GRCm39) missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25,505,313 (GRCm39) missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25,559,382 (GRCm39) missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25,571,175 (GRCm39) missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25,519,025 (GRCm39) nonsense probably null
R4781:Kmt2c UTSW 5 25,648,823 (GRCm39) missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25,520,111 (GRCm39) missense probably benign
R4855:Kmt2c UTSW 5 25,519,555 (GRCm39) missense probably benign 0.00
R4919:Kmt2c UTSW 5 25,519,393 (GRCm39) missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25,515,870 (GRCm39) missense probably benign 0.00
R4983:Kmt2c UTSW 5 25,500,509 (GRCm39) missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25,504,710 (GRCm39) nonsense probably null
R5033:Kmt2c UTSW 5 25,519,706 (GRCm39) missense probably benign 0.03
R5093:Kmt2c UTSW 5 25,614,205 (GRCm39) missense probably benign 0.17
R5125:Kmt2c UTSW 5 25,489,379 (GRCm39) missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25,520,471 (GRCm39) missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25,519,592 (GRCm39) missense probably benign 0.01
R5396:Kmt2c UTSW 5 25,499,732 (GRCm39) splice site probably null
R5415:Kmt2c UTSW 5 25,519,699 (GRCm39) missense probably benign 0.21
R5523:Kmt2c UTSW 5 25,504,337 (GRCm39) missense probably benign 0.00
R5554:Kmt2c UTSW 5 25,499,608 (GRCm39) missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25,519,015 (GRCm39) missense probably benign 0.16
R5762:Kmt2c UTSW 5 25,515,455 (GRCm39) missense probably benign 0.01
R5819:Kmt2c UTSW 5 25,614,130 (GRCm39) critical splice donor site probably null
R5838:Kmt2c UTSW 5 25,489,469 (GRCm39) missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25,552,467 (GRCm39) missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25,535,801 (GRCm39) missense probably benign 0.15
R5988:Kmt2c UTSW 5 25,516,118 (GRCm39) missense probably benign 0.02
R5999:Kmt2c UTSW 5 25,489,203 (GRCm39) missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25,504,127 (GRCm39) missense probably benign
R6254:Kmt2c UTSW 5 25,554,872 (GRCm39) missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25,648,816 (GRCm39) critical splice donor site probably null
R6329:Kmt2c UTSW 5 25,520,600 (GRCm39) missense probably benign 0.01
R6347:Kmt2c UTSW 5 25,515,833 (GRCm39) missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25,514,634 (GRCm39) missense probably null 0.99
R6379:Kmt2c UTSW 5 25,564,339 (GRCm39) missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25,528,787 (GRCm39) missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25,503,926 (GRCm39) missense probably benign
R6733:Kmt2c UTSW 5 25,614,291 (GRCm39) missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25,480,737 (GRCm39) splice site probably null
R6816:Kmt2c UTSW 5 25,610,530 (GRCm39) splice site probably null
R6862:Kmt2c UTSW 5 25,515,515 (GRCm39) missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25,505,360 (GRCm39) missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25,549,923 (GRCm39) missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25,514,805 (GRCm39) missense probably benign 0.00
R7250:Kmt2c UTSW 5 25,504,489 (GRCm39) missense probably damaging 1.00
R7402:Kmt2c UTSW 5 25,600,418 (GRCm39) missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25,507,847 (GRCm39) missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25,513,530 (GRCm39) missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25,489,562 (GRCm39) missense probably damaging 0.99
R7637:Kmt2c UTSW 5 25,520,093 (GRCm39) missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25,520,717 (GRCm39) missense probably benign 0.01
R7714:Kmt2c UTSW 5 25,580,364 (GRCm39) missense probably benign
R7838:Kmt2c UTSW 5 25,499,697 (GRCm39) missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25,505,109 (GRCm39) missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25,504,814 (GRCm39) missense probably benign 0.18
R7895:Kmt2c UTSW 5 25,578,174 (GRCm39) missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25,520,194 (GRCm39) missense probably benign 0.01
R7974:Kmt2c UTSW 5 25,505,561 (GRCm39) missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25,564,676 (GRCm39) missense probably benign 0.00
R8011:Kmt2c UTSW 5 25,556,232 (GRCm39) missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25,492,117 (GRCm39) missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25,486,678 (GRCm39) missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25,507,730 (GRCm39) missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25,534,250 (GRCm39) missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25,486,382 (GRCm39) missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25,579,562 (GRCm39) missense probably benign 0.00
R8169:Kmt2c UTSW 5 25,559,685 (GRCm39) missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25,519,537 (GRCm39) missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25,488,104 (GRCm39) missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25,529,216 (GRCm39) missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25,610,514 (GRCm39) missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25,509,692 (GRCm39) missense probably null 1.00
R8355:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25,519,120 (GRCm39) missense probably benign 0.34
R8885:Kmt2c UTSW 5 25,520,077 (GRCm39) missense probably benign 0.34
R8907:Kmt2c UTSW 5 25,514,609 (GRCm39) missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25,503,885 (GRCm39) missense probably benign
R8969:Kmt2c UTSW 5 25,519,387 (GRCm39) missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25,488,208 (GRCm39) missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25,524,010 (GRCm39) missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25,489,343 (GRCm39) missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25,489,194 (GRCm39) missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25,516,102 (GRCm39) missense probably benign 0.01
R9171:Kmt2c UTSW 5 25,486,309 (GRCm39) missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25,504,997 (GRCm39) missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9288:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9336:Kmt2c UTSW 5 25,614,165 (GRCm39) missense probably benign 0.06
R9443:Kmt2c UTSW 5 25,515,045 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9526:Kmt2c UTSW 5 25,486,355 (GRCm39) missense probably damaging 1.00
R9653:Kmt2c UTSW 5 25,507,819 (GRCm39) missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25,489,758 (GRCm39) missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25,577,956 (GRCm39) missense probably benign 0.18
R9784:Kmt2c UTSW 5 25,549,959 (GRCm39) missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF006:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF011:Kmt2c UTSW 5 25,543,457 (GRCm39) missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF047:Kmt2c UTSW 5 25,520,758 (GRCm39) small insertion probably benign
RF051:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF055:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF059:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF063:Kmt2c UTSW 5 25,520,762 (GRCm39) small insertion probably benign
X0024:Kmt2c UTSW 5 25,610,483 (GRCm39) missense probably benign 0.26
X0027:Kmt2c UTSW 5 25,535,885 (GRCm39) missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25,559,411 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25,571,195 (GRCm39) critical splice acceptor site probably null
Z1177:Kmt2c UTSW 5 25,505,001 (GRCm39) missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25,500,395 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGATAAAGTCCCACCCAGGTCC -3'
(R):5'- ACATGATGCTGATGACTGTTTTGC -3'

Sequencing Primer
(F):5'- CAAGCCCTGTCTCCAGTCAGTATAC -3'
(R):5'- ATGCTGATGACTGTTTTGCATTAGC -3'
Posted On 2019-10-17