Incidental Mutation 'R7549:Rassf6'
ID 584378
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
MMRRC Submission 045620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R7549 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 90754661 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 206 (I206L)
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031317
AA Change: I219L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370
AA Change: I219L

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202704
AA Change: I219L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370
AA Change: I219L

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202784
AA Change: I206L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370
AA Change: I206L

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adam1b A G 5: 121,639,981 (GRCm39) C355R probably damaging Het
Adamtsl3 T C 7: 82,223,117 (GRCm39) L966P probably damaging Het
Aldh18a1 A G 19: 40,553,291 (GRCm39) C486R probably damaging Het
Aqp11 C A 7: 97,387,284 (GRCm39) probably benign Het
Arhgap28 A G 17: 68,178,961 (GRCm39) L350P probably damaging Het
Art3 A G 5: 92,551,514 (GRCm39) Q291R probably benign Het
Asb15 A G 6: 24,559,029 (GRCm39) probably null Het
Bmp8b T C 4: 122,999,448 (GRCm39) I102T possibly damaging Het
Bsn T C 9: 107,992,014 (GRCm39) D1246G probably benign Het
Cass4 G A 2: 172,268,718 (GRCm39) G267S probably benign Het
Cass4 G T 2: 172,268,719 (GRCm39) G267V probably benign Het
Ccr7 T C 11: 99,036,727 (GRCm39) Y65C probably damaging Het
Clstn2 A C 9: 97,464,597 (GRCm39) I186S probably benign Het
Cyp2r1 A G 7: 114,153,879 (GRCm39) I105T possibly damaging Het
Efr3a T A 15: 65,687,262 (GRCm39) probably null Het
Erg A C 16: 95,170,179 (GRCm39) probably null Het
Eya4 A T 10: 22,987,557 (GRCm39) V524E probably damaging Het
Farp1 C A 14: 121,472,589 (GRCm39) N241K possibly damaging Het
Fat1 A T 8: 45,442,031 (GRCm39) Y1111F probably benign Het
Fbn1 T C 2: 125,185,947 (GRCm39) E1607G probably damaging Het
Fbn2 A T 18: 58,153,536 (GRCm39) C2575* probably null Het
Fsip2 A T 2: 82,824,337 (GRCm39) D6690V probably damaging Het
Fzd4 T C 7: 89,056,346 (GRCm39) V131A possibly damaging Het
Gfral T A 9: 76,106,257 (GRCm39) N110I probably benign Het
Glce T C 9: 61,968,275 (GRCm39) D292G probably damaging Het
Gm19410 T A 8: 36,266,500 (GRCm39) I1051K probably benign Het
Gm5773 A T 3: 93,680,323 (GRCm39) probably benign Het
Hcn3 A T 3: 89,057,307 (GRCm39) H430Q probably null Het
Hspa8 T A 9: 40,714,255 (GRCm39) probably null Het
Ifna7 A T 4: 88,734,664 (GRCm39) D67V possibly damaging Het
Kif5c T A 2: 49,591,105 (GRCm39) M319K probably benign Het
Klk7 G T 7: 43,462,197 (GRCm39) probably null Het
Kmt2c T C 5: 25,619,968 (GRCm39) K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrp1b C T 2: 40,765,134 (GRCm39) M2897I Het
Lysmd2 T C 9: 75,544,519 (GRCm39) S211P probably damaging Het
Magi1 T G 6: 93,685,095 (GRCm39) E761A probably benign Het
Mbd5 T A 2: 49,141,355 (GRCm39) I106N probably damaging Het
Mdc1 G A 17: 36,159,749 (GRCm39) A669T probably null Het
Mmp1b A G 9: 7,384,753 (GRCm39) I265T probably benign Het
Mmp2 T A 8: 93,563,594 (GRCm39) L356Q probably null Het
Mroh8 A G 2: 157,111,492 (GRCm39) L154P probably benign Het
Muc13 T C 16: 33,619,806 (GRCm39) S185P unknown Het
Nuak1 T A 10: 84,210,403 (GRCm39) I562F probably benign Het
Obscn C A 11: 58,933,664 (GRCm39) probably null Het
Or51t4 T C 7: 102,597,798 (GRCm39) I42T possibly damaging Het
Or5w14 A T 2: 87,542,115 (GRCm39) M45K probably damaging Het
Or9k7 T C 10: 130,046,853 (GRCm39) M49V probably benign Het
Pex3 T C 10: 13,418,414 (GRCm39) M81V probably benign Het
Pex5l T A 3: 33,136,184 (GRCm39) I12F probably benign Het
Phf3 G T 1: 30,870,556 (GRCm39) T164N probably benign Het
Phpt1 G T 2: 25,464,844 (GRCm39) A3E probably benign Het
Pja2 A T 17: 64,616,410 (GRCm39) L162M probably damaging Het
Pkdrej T A 15: 85,703,994 (GRCm39) K647N probably damaging Het
Ppp2r1a T C 17: 21,182,944 (GRCm39) S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 (GRCm39) D473Y probably damaging Het
Prl6a1 A T 13: 27,502,954 (GRCm39) E183D probably damaging Het
Psmd3 C T 11: 98,581,787 (GRCm39) T304M probably benign Het
Ptpn5 C T 7: 46,735,874 (GRCm39) probably null Het
Rif1 A G 2: 51,968,519 (GRCm39) H234R possibly damaging Het
Rint1 T C 5: 24,020,702 (GRCm39) V575A probably benign Het
Ros1 G A 10: 52,021,930 (GRCm39) T639I probably damaging Het
Ryr2 A G 13: 11,752,871 (GRCm39) F1817L probably benign Het
Ska1 T C 18: 74,333,088 (GRCm39) D110G probably benign Het
Slc25a41 G A 17: 57,340,791 (GRCm39) T227I probably damaging Het
Slc6a15 T C 10: 103,224,998 (GRCm39) S29P probably benign Het
Slc8a3 A T 12: 81,361,544 (GRCm39) I425K probably benign Het
Sox8 T A 17: 25,786,935 (GRCm39) Q256L probably damaging Het
Tars3 T C 7: 65,297,341 (GRCm39) V152A probably damaging Het
Tbx10 A T 19: 4,046,651 (GRCm39) T44S probably benign Het
Terb1 T A 8: 105,224,716 (GRCm39) I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,740 (GRCm39) probably null Het
Tgm1 A G 14: 55,943,360 (GRCm39) V527A probably benign Het
Tmed10 G T 12: 85,391,036 (GRCm39) Y167* probably null Het
Tmem165 T G 5: 76,356,415 (GRCm39) S318R possibly damaging Het
Trim9 G T 12: 70,393,715 (GRCm39) S76R probably damaging Het
Tti1 A G 2: 157,849,088 (GRCm39) V717A probably damaging Het
Vmn2r86 T A 10: 130,282,697 (GRCm39) I640F probably damaging Het
Vwf A G 6: 125,603,230 (GRCm39) N860S Het
Xirp2 A G 2: 67,339,241 (GRCm39) K494R possibly damaging Het
Zkscan4 G A 13: 21,668,419 (GRCm39) S319N probably damaging Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5134:Rassf6 UTSW 5 90,752,225 (GRCm39) critical splice acceptor site probably null
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGACATCTTCCCAGCTC -3'
(R):5'- GGAGTTGCATCATCACTTCTTAG -3'

Sequencing Primer
(F):5'- TGGGCTACAGCTACCCCAAG -3'
(R):5'- ACTTCTTAGAATTACATCCCCCAC -3'
Posted On 2019-10-17