Mutagenetix > Incidental Mutation

Incidental Mutation 'R0617:Atm'

58439

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

038806-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R0617 (G1)

Quality Score

220

Status

Validated

Chromosome

Chromosomal Location

53439149-53536740 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 53458941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 2290 (Y2290*)

Ref Sequence

ENSEMBL: ENSMUSP00000156344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000118282
AA Change: Y2287*

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: Y2287*

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000232179
AA Change: Y2290*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

98% (130/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	C	A	19: 11,112,400	L40F	probably damaging	Het
4930555F03Rik	A	T	8: 49,500,492		noncoding transcript	Het
A630073D07Rik	T	C	6: 132,626,737		probably benign	Het
Abca16	G	A	7: 120,433,611		probably benign	Het
Abca5	A	T	11: 110,279,689	D1265E	probably damaging	Het
Abcf1	C	T	17: 35,961,187	V312I	probably benign	Het
Abhd12	T	A	2: 150,846,365		probably null	Het
Adam23	A	G	1: 63,543,147	H318R	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Adgrf3	T	C	5: 30,195,080	T972A	probably benign	Het
Adipoq	T	A	16: 23,155,410	D62E	probably damaging	Het
Akap2	T	C	4: 57,829,434		probably benign	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Arap2	AT	ATT	5: 62,649,907		probably benign	Het
Arhgef28	G	T	13: 97,970,355	T687K	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
Atad2b	C	A	12: 4,937,401	D76E	probably benign	Het
Atrn	T	A	2: 130,995,085		probably null	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Bsn	T	C	9: 108,107,240	E3205G	unknown	Het
Cacna1c	T	C	6: 118,602,213	Y1599C	probably damaging	Het
Ccdc40	A	G	11: 119,242,804	D590G	probably damaging	Het
Ccdc68	A	G	18: 69,946,552		probably null	Het
Ccdc97	G	A	7: 25,714,420	R279C	probably damaging	Het
Ccm2l	A	G	2: 153,070,900	T120A	probably damaging	Het
Cfap54	T	C	10: 92,829,650		probably benign	Het
Cfh	A	G	1: 140,100,883	S1043P	probably benign	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Cib2	T	C	9: 54,554,496	D26G	possibly damaging	Het
Col24a1	T	C	3: 145,314,120	V84A	probably damaging	Het
Csn3	T	C	5: 87,929,871	Y79H	probably benign	Het
Ddx47	T	A	6: 135,017,122	V149E	probably damaging	Het
Dennd5b	A	T	6: 149,033,262		probably benign	Het
Desi1	T	C	15: 81,998,198	N109D	probably damaging	Het
Fam13c	T	C	10: 70,536,352		probably benign	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fanca	A	G	8: 123,288,070	F831S	probably damaging	Het
Fancm	C	T	12: 65,097,317	R518*	probably null	Het
Fat2	A	G	11: 55,311,843	V135A	possibly damaging	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Fgd3	A	T	13: 49,264,697	V631E	possibly damaging	Het
Fhod3	G	A	18: 25,112,679		probably benign	Het
Focad	T	C	4: 88,121,288		probably benign	Het
Foxn4	C	A	5: 114,261,068		probably benign	Het
Gm1673	T	C	5: 33,983,552		probably benign	Het
Gm2381	A	T	7: 42,819,978	C241S	probably damaging	Het
Gm6483	T	G	8: 19,693,709	F117V	probably damaging	Het
Hectd4	T	C	5: 121,343,232		probably benign	Het
Hecw1	T	A	13: 14,280,442	Q676L	probably benign	Het
Hipk2	G	A	6: 38,747,485	R437C	possibly damaging	Het
Ifnar1	T	C	16: 91,501,682	Y396H	probably damaging	Het
Ints5	A	T	19: 8,896,019	K447N	probably damaging	Het
Iqsec1	T	C	6: 90,689,970	Y495C	probably damaging	Het
Itga5	C	T	15: 103,356,315		probably null	Het
Kcnk4	T	A	19: 6,928,160		probably benign	Het
Kmo	A	G	1: 175,647,190	T174A	possibly damaging	Het
Krt36	T	C	11: 100,102,275	D458G	probably damaging	Het
Krtap16-1	G	T	11: 99,986,495	P28T	probably damaging	Het
Lama3	T	C	18: 12,419,258		probably null	Het
Lrrc9	T	C	12: 72,483,014	S920P	probably damaging	Het
Lrrk2	A	T	15: 91,752,278	Y1485F	probably benign	Het
Mical1	C	T	10: 41,481,315	A372V	probably damaging	Het
Mtr	C	T	13: 12,221,432	R636Q	probably benign	Het
Muc4	A	T	16: 32,752,107	T662S	possibly damaging	Het
Myo10	G	A	15: 25,738,005	V546M	probably damaging	Het
Nbeal1	G	A	1: 60,281,832	W2034*	probably null	Het
Nhlrc3	T	C	3: 53,458,623	T150A	probably damaging	Het
Nkx2-1	T	C	12: 56,534,855	H69R	possibly damaging	Het
Nlrp4g	A	T	9: 124,349,540		noncoding transcript	Het
Nod2	A	G	8: 88,653,231	N120S	probably benign	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1124	A	G	2: 87,434,661	D58G	probably damaging	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr1459	T	C	19: 13,146,363	M99V	probably benign	Het
Olfr1477	C	A	19: 13,502,536	N64K	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr640	A	T	7: 104,021,989	S110T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pcdhb8	C	T	18: 37,357,047	R593C	probably benign	Het
Pgm3	A	G	9: 86,556,190		probably null	Het
Pirt	T	A	11: 66,926,172	V103E	probably damaging	Het
Plxnc1	T	A	10: 94,799,368	D1332V	probably damaging	Het
Ppfia4	A	T	1: 134,328,780	V122E	probably damaging	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prmt2	C	T	10: 76,208,683		probably benign	Het
Prrc2a	G	T	17: 35,153,560	P1702T	probably damaging	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Rb1cc1	T	A	1: 6,248,790	I794K	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Sbf2	ACC	AC	7: 110,330,683		probably null	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Setx	T	A	2: 29,146,807	H1101Q	possibly damaging	Het
Sis	A	G	3: 72,965,605	C67R	probably damaging	Het
Skint1	T	A	4: 112,029,399		probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata31d1a	A	T	13: 59,702,259	I685N	possibly damaging	Het
Spef2	T	A	15: 9,592,758	N1499I	probably damaging	Het
Stk11ip	T	A	1: 75,532,288		probably null	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Svil	T	C	18: 5,117,002	S2059P	probably damaging	Het
Syne1	C	T	10: 5,350,933	V932M	probably damaging	Het
Tacc1	A	C	8: 25,178,004		probably benign	Het
Tbc1d13	C	A	2: 30,135,564		probably benign	Het
Tbc1d15	A	C	10: 115,239,299	D59E	probably damaging	Het
Tcaf2	A	G	6: 42,642,511	F194S	probably damaging	Het
Terf2ip	T	A	8: 112,011,495	M5K	probably benign	Het
Tgfbr2	A	T	9: 116,158,320	D40E	probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmprss3	A	T	17: 31,193,912	C129S	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Tnr	A	G	1: 159,868,103	D532G	probably damaging	Het
Tnrc18	T	A	5: 142,776,739	H465L	unknown	Het
Togaram2	A	T	17: 71,700,509	Q350L	possibly damaging	Het
Topaz1	G	A	9: 122,749,906	C627Y	possibly damaging	Het
Tpx2	A	T	2: 152,873,138	Q93L	probably benign	Het
Trim54	T	C	5: 31,136,182		probably null	Het
Troap	T	A	15: 99,082,660	C574S	probably damaging	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Vmn2r51	A	G	7: 10,100,469	V214A	possibly damaging	Het
Vmn2r66	A	T	7: 84,995,276	M642K	probably benign	Het
Vwa5a	T	A	9: 38,723,895	I232N	probably damaging	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp820	A	T	17: 21,819,704	S214R	probably damaging	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het
Zgrf1	C	T	3: 127,588,038	T1162M	probably benign	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53524443	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53499112	splice site	probably benign
IGL00567:Atm	APN	9	53503116	nonsense	probably null
IGL00702:Atm	APN	9	53511831	missense	probably benign	0.02
IGL00743:Atm	APN	9	53513116	missense	probably benign	0.00
IGL00771:Atm	APN	9	53493054	missense	probably benign	0.01
IGL00773:Atm	APN	9	53522144	missense	probably benign	0.00
IGL00819:Atm	APN	9	53518531	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53533933	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53459816	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53490293	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53461122	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53515317	missense	probably benign
IGL01374:Atm	APN	9	53531724	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53439746	makesense	probably null
IGL01409:Atm	APN	9	53499171	missense	probably benign	0.01
IGL01434:Atm	APN	9	53507807	missense	probably benign	0.04
IGL01486:Atm	APN	9	53510213	missense	probably benign
IGL01583:Atm	APN	9	53484247	splice site	probably benign
IGL01861:Atm	APN	9	53494612	missense	probably null	0.89
IGL01865:Atm	APN	9	53461002	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53442417	splice site	probably null
IGL02072:Atm	APN	9	53459796	missense	probably benign	0.01
IGL02075:Atm	APN	9	53527237	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53487983	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53480665	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53527185	missense	probably benign	0.12
IGL02259:Atm	APN	9	53518494	splice site	probably benign
IGL02351:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02358:Atm	APN	9	53522176	missense	probably benign	0.04
IGL02387:Atm	APN	9	53479766	splice site	probably null
IGL02417:Atm	APN	9	53479695	missense	probably benign	0.00
IGL02422:Atm	APN	9	53500792	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53454330	missense	probably benign	0.00
IGL02492:Atm	APN	9	53455859	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53497262	splice site	probably benign
IGL02633:Atm	APN	9	53448153	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53516563	missense	probably benign	0.00
IGL02948:Atm	APN	9	53453440	splice site	probably benign
IGL02959:Atm	APN	9	53471418	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53453563	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53484171	missense	possibly damaging	0.89
antebellum	UTSW	9	53518559	nonsense	probably null
bull_run	UTSW	9	53487922	missense	probably benign	0.09
Civil	UTSW	9	53492268	missense	possibly damaging	0.78
gettysburg	UTSW	9	53455988	splice site	probably null
Grant	UTSW	9	53511917	nonsense	probably null
Indicative	UTSW	9	53445376	splice site	probably null
Marker	UTSW	9	53454279	splice site	probably benign
maunder	UTSW	9	53499197	nonsense	probably null
mockingbird	UTSW	9	53516467	nonsense	probably null
mockingbird2	UTSW	9	53488587	missense	probably damaging	1.00
osphere	UTSW	9	53479673	missense	probably damaging	0.99
shiloh	UTSW	9	53465298	missense	probably damaging	1.00
Strato	UTSW	9	53503018	missense	probably damaging	1.00
thrasher	UTSW	9	53445507	missense	probably benign	0.01
Tropo	UTSW	9	53531648	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53465028	splice site	probably benign
PIT4403001:Atm	UTSW	9	53500982	missense	probably benign
PIT4687001:Atm	UTSW	9	53486812	critical splice donor site	probably null
R0004:Atm	UTSW	9	53453528	splice site	probably benign
R0035:Atm	UTSW	9	53513180	missense	probably benign	0.01
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0098:Atm	UTSW	9	53518569	missense	probably benign	0.10
R0201:Atm	UTSW	9	53454279	splice site	probably benign
R0304:Atm	UTSW	9	53516344	missense	probably benign	0.34
R0308:Atm	UTSW	9	53454473	splice site	probably null
R0362:Atm	UTSW	9	53458838	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53460966	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53503948	missense	probably benign	0.00
R0589:Atm	UTSW	9	53490192	missense	possibly damaging	0.51
R0630:Atm	UTSW	9	53531622	splice site	probably benign
R0652:Atm	UTSW	9	53486014	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53515239	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53456566	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53459823	missense	probably benign
R0947:Atm	UTSW	9	53504092	missense	probably benign	0.01
R0948:Atm	UTSW	9	53495958	missense	probably benign
R1144:Atm	UTSW	9	53511698	splice site	probably benign
R1252:Atm	UTSW	9	53455840	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53457489	missense	probably benign	0.00
R1477:Atm	UTSW	9	53464273	missense	probably benign	0.00
R1596:Atm	UTSW	9	53453378	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53479673	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53500932	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53522155	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53500700	missense	probably benign
R1817:Atm	UTSW	9	53492233	splice site	probably benign
R1840:Atm	UTSW	9	53456530	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53468012	missense	probably benign	0.06
R1906:Atm	UTSW	9	53506568	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53471418	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53443997	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53500969	missense	probably benign	0.36
R2134:Atm	UTSW	9	53467964	critical splice donor site	probably null
R2137:Atm	UTSW	9	53453375	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53490909	splice site	probably null
R2348:Atm	UTSW	9	53492268	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53510266	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53457470	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53507805	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53494711	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53480750	missense	probably benign	0.00
R3236:Atm	UTSW	9	53479748	missense	probably benign	0.15
R3847:Atm	UTSW	9	53503075	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53506636	splice site	probably benign
R3919:Atm	UTSW	9	53492278	missense	probably benign	0.00
R4125:Atm	UTSW	9	53450621	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53480669	missense	probably benign
R4395:Atm	UTSW	9	53465227	missense	probably benign	0.09
R4466:Atm	UTSW	9	53448169	nonsense	probably null
R4502:Atm	UTSW	9	53495946	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53493039	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53500759	missense	probably benign	0.39
R4593:Atm	UTSW	9	53453594	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53456506	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53531733	missense	probably benign	0.01
R4665:Atm	UTSW	9	53464229	missense	probably benign	0.00
R4672:Atm	UTSW	9	53522201	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53453607	missense	probably benign	0.10
R4808:Atm	UTSW	9	53445495	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53515301	missense	probably benign
R4996:Atm	UTSW	9	53524507	missense	probably benign	0.09
R5030:Atm	UTSW	9	53520109	nonsense	probably null
R5214:Atm	UTSW	9	53491027	missense	probably benign	0.09
R5260:Atm	UTSW	9	53506611	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53518623	missense	probably benign	0.00
R5394:Atm	UTSW	9	53507777	critical splice donor site	probably null
R5400:Atm	UTSW	9	53503018	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53459804	missense	probably benign	0.00
R5441:Atm	UTSW	9	53516467	nonsense	probably null
R5569:Atm	UTSW	9	53516450	nonsense	probably null
R5856:Atm	UTSW	9	53495955	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53497159	missense	probably benign
R5910:Atm	UTSW	9	53448080	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53459873	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53488587	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53524414	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53524509	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53490959	missense	probably benign	0.04
R6267:Atm	UTSW	9	53444000	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53487922	missense	probably benign	0.09
R6284:Atm	UTSW	9	53445376	splice site	probably null
R6478:Atm	UTSW	9	53490254	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53440157	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53493177	missense	probably benign	0.00
R6704:Atm	UTSW	9	53458853	missense	probably benign	0.02
R6715:Atm	UTSW	9	53531648	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53486051	missense	probably benign	0.30
R6759:Atm	UTSW	9	53518559	nonsense	probably null
R6766:Atm	UTSW	9	53490282	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53497235	missense	probably benign	0.00
R6852:Atm	UTSW	9	53482430	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53507881	missense	probably benign	0.02
R7208:Atm	UTSW	9	53512008	splice site	probably null
R7211:Atm	UTSW	9	53488560	missense	probably benign	0.01
R7220:Atm	UTSW	9	53511917	nonsense	probably null
R7336:Atm	UTSW	9	53462503	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53465298	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53453437	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53448125	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53524354	missense	probably benign
R7497:Atm	UTSW	9	53511891	missense	probably benign	0.00
R7584:Atm	UTSW	9	53513127	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53454768	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53490302	nonsense	probably null
R7660:Atm	UTSW	9	53445507	missense	probably benign	0.01
R7679:Atm	UTSW	9	53442497	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53522239	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53455988	splice site	probably null
R8247:Atm	UTSW	9	53450570	missense
R8334:Atm	UTSW	9	53522273	missense	probably benign	0.00
R8503:Atm	UTSW	9	53488052	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53524497	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53499197	nonsense	probably null
R8838:Atm	UTSW	9	53516551	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53458834	missense	probably benign	0.01
R9131:Atm	UTSW	9	53533744	missense	probably benign	0.10
R9191:Atm	UTSW	9	53527290	missense	probably benign	0.29
R9257:Atm	UTSW	9	53495850	critical splice donor site	probably null
R9473:Atm	UTSW	9	53498972	missense	probably benign
R9558:Atm	UTSW	9	53500781	missense	probably benign	0.00
R9598:Atm	UTSW	9	53520081	missense	probably benign	0.34
R9717:Atm	UTSW	9	53516517	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53518567	missense	probably benign
X0067:Atm	UTSW	9	53479694	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53531687	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCAATCACGGATGCAGCCACC -3'
(R):5'- TCTGGGATCAAACCCCAGTATCGAG -3'

Sequencing Primer
(F):5'- GATGCAGCCACCCCACC -3'
(R):5'- ctctctctctctctctctctctc -3'

Posted On

2013-07-11