Incidental Mutation 'R7549:Eya4'
ID584402
Institutional Source Beutler Lab
Gene Symbol Eya4
Ensembl Gene ENSMUSG00000010461
Gene NameEYA transcriptional coactivator and phosphatase 4
SynonymsB130023L16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7549 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23102963-23350786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23111658 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 524 (V524E)
Ref Sequence ENSEMBL: ENSMUSP00000090335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074366] [ENSMUST00000092665] [ENSMUST00000219315] [ENSMUST00000220299]
Predicted Effect probably damaging
Transcript: ENSMUST00000074366
AA Change: V524E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073970
Gene: ENSMUSG00000010461
AA Change: V524E

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-163 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000092665
AA Change: V524E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090335
Gene: ENSMUSG00000010461
AA Change: V524E

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
PDB:4EGC|B 336 616 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000219315
AA Change: V547E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000220299
AA Change: V524E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant non-syndromic sensorineural 10 locus. The encoded protein is also a putative oncogene that mediates DNA repair, apoptosis, and innate immunity following DNA damage, cellular damage, and viral attack. Defects in this gene are also associated with dilated cardiomyopathy 1J. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show strain background-dependent postnatal lethality, reduced body weight, male sterility, a delay in palate bone fusion, developmental defects in the eustachian tube and middle ear cavity, early-onset hearing deficits, and profound susceptibility to otitis media with effusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adam1b A G 5: 121,501,918 C355R probably damaging Het
Adamtsl3 T C 7: 82,573,909 L966P probably damaging Het
Aldh18a1 A G 19: 40,564,847 C486R probably damaging Het
Aqp11 C A 7: 97,738,077 probably benign Het
Arhgap28 A G 17: 67,871,966 L350P probably damaging Het
Art3 A G 5: 92,403,655 Q291R probably benign Het
Asb15 A G 6: 24,559,030 probably null Het
Bmp8b T C 4: 123,105,655 I102T possibly damaging Het
Bsn T C 9: 108,114,815 D1246G probably benign Het
Cass4 G A 2: 172,426,798 G267S probably benign Het
Cass4 G T 2: 172,426,799 G267V probably benign Het
Ccr7 T C 11: 99,145,901 Y65C probably damaging Het
Clstn2 A C 9: 97,582,544 I186S probably benign Het
Cyp2r1 A G 7: 114,554,644 I105T possibly damaging Het
Efr3a T A 15: 65,815,413 probably null Het
Erg A C 16: 95,369,320 probably null Het
Farp1 C A 14: 121,235,177 N241K possibly damaging Het
Fat1 A T 8: 44,988,994 Y1111F probably benign Het
Fbn1 T C 2: 125,344,027 E1607G probably damaging Het
Fbn2 A T 18: 58,020,464 C2575* probably null Het
Fsip2 A T 2: 82,993,993 D6690V probably damaging Het
Fzd4 T C 7: 89,407,138 V131A possibly damaging Het
Gfral T A 9: 76,198,975 N110I probably benign Het
Glce T C 9: 62,060,993 D292G probably damaging Het
Gm19410 T A 8: 35,799,346 I1051K probably benign Het
Gm5773 A T 3: 93,773,016 probably benign Het
Hcn3 A T 3: 89,150,000 H430Q probably null Het
Hspa8 T A 9: 40,802,959 probably null Het
Ifna7 A T 4: 88,816,427 D67V possibly damaging Het
Kif5c T A 2: 49,701,093 M319K probably benign Het
Klk7 G T 7: 43,812,773 probably null Het
Kmt2c T C 5: 25,414,970 K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b C T 2: 40,875,122 M2897I Het
Lysmd2 T C 9: 75,637,237 S211P probably damaging Het
Magi1 T G 6: 93,708,114 E761A probably benign Het
Mbd5 T A 2: 49,251,343 I106N probably damaging Het
Mdc1 G A 17: 35,848,857 A669T probably null Het
Mmp1b A G 9: 7,384,753 I265T probably benign Het
Mmp2 T A 8: 92,836,966 L356Q probably null Het
Mroh8 A G 2: 157,269,572 L154P probably benign Het
Muc13 T C 16: 33,799,436 S185P unknown Het
Nuak1 T A 10: 84,374,539 I562F probably benign Het
Obscn C A 11: 59,042,838 probably null Het
Olfr1137 A T 2: 87,711,771 M45K probably damaging Het
Olfr574 T C 7: 102,948,591 I42T possibly damaging Het
Olfr827 T C 10: 130,210,984 M49V probably benign Het
Pex3 T C 10: 13,542,670 M81V probably benign Het
Pex5l T A 3: 33,082,035 I12F probably benign Het
Phf3 G T 1: 30,831,475 T164N probably benign Het
Phpt1 G T 2: 25,574,832 A3E probably benign Het
Pja2 A T 17: 64,309,415 L162M probably damaging Het
Pkdrej T A 15: 85,819,793 K647N probably damaging Het
Ppp2r1a T C 17: 20,962,682 S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 D473Y probably damaging Het
Prl6a1 A T 13: 27,318,971 E183D probably damaging Het
Psmd3 C T 11: 98,690,961 T304M probably benign Het
Ptpn5 C T 7: 47,086,126 probably null Het
Rassf6 T G 5: 90,606,802 I206L probably damaging Het
Rif1 A G 2: 52,078,507 H234R possibly damaging Het
Rint1 T C 5: 23,815,704 V575A probably benign Het
Ros1 G A 10: 52,145,834 T639I probably damaging Het
Ryr2 A G 13: 11,737,985 F1817L probably benign Het
Ska1 T C 18: 74,200,017 D110G probably benign Het
Slc25a41 G A 17: 57,033,791 T227I probably damaging Het
Slc6a15 T C 10: 103,389,137 S29P probably benign Het
Slc8a3 A T 12: 81,314,770 I425K probably benign Het
Sox8 T A 17: 25,567,961 Q256L probably damaging Het
Tarsl2 T C 7: 65,647,593 V152A probably damaging Het
Tbx10 A T 19: 3,996,651 T44S probably benign Het
Terb1 T A 8: 104,498,084 I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,741 probably null Het
Tgm1 A G 14: 55,705,903 V527A probably benign Het
Tmed10 G T 12: 85,344,262 Y167* probably null Het
Tmem165 T G 5: 76,208,568 S318R possibly damaging Het
Trim9 G T 12: 70,346,941 S76R probably damaging Het
Tti1 A G 2: 158,007,168 V717A probably damaging Het
Vmn2r86 T A 10: 130,446,828 I640F probably damaging Het
Vwf A G 6: 125,626,267 N860S Het
Xirp2 A G 2: 67,508,897 K494R possibly damaging Het
Zkscan4 G A 13: 21,484,249 S319N probably damaging Het
Other mutations in Eya4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Eya4 APN 10 23159097 missense probably benign 0.17
IGL00507:Eya4 APN 10 23157536 nonsense probably null
IGL01324:Eya4 APN 10 23116551 critical splice donor site probably null
IGL01350:Eya4 APN 10 23113974 missense possibly damaging 0.88
IGL01397:Eya4 APN 10 23139999 missense probably benign 0.01
IGL02682:Eya4 APN 10 23116600 missense probably damaging 1.00
IGL02688:Eya4 APN 10 23159110 missense probably benign 0.01
IGL03071:Eya4 APN 10 23323073 missense probably benign 0.07
R0420:Eya4 UTSW 10 23155963 missense possibly damaging 0.85
R1688:Eya4 UTSW 10 23123861 missense probably damaging 1.00
R2312:Eya4 UTSW 10 23106264 missense probably damaging 1.00
R3029:Eya4 UTSW 10 23123878 missense probably benign
R3853:Eya4 UTSW 10 23116676 missense probably damaging 1.00
R3872:Eya4 UTSW 10 23155972 missense probably damaging 0.97
R4113:Eya4 UTSW 10 23155951 missense probably damaging 0.98
R4210:Eya4 UTSW 10 23226800 critical splice donor site probably null
R4457:Eya4 UTSW 10 23116668 missense probably damaging 1.00
R4691:Eya4 UTSW 10 23140068 missense probably benign 0.03
R4894:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5345:Eya4 UTSW 10 23110048 missense probably benign 0.00
R5473:Eya4 UTSW 10 23163453 missense probably benign 0.02
R5547:Eya4 UTSW 10 23109854 missense possibly damaging 0.55
R5698:Eya4 UTSW 10 23140077 missense possibly damaging 0.50
R5951:Eya4 UTSW 10 23155994 missense probably damaging 1.00
R5953:Eya4 UTSW 10 23151973 missense probably damaging 1.00
R6111:Eya4 UTSW 10 23140055 missense possibly damaging 0.67
R6413:Eya4 UTSW 10 23116826 missense probably damaging 1.00
R6460:Eya4 UTSW 10 23152012 missense probably benign 0.05
R7144:Eya4 UTSW 10 23173045 missense probably benign 0.00
R7169:Eya4 UTSW 10 23155947 missense probably benign 0.42
R7358:Eya4 UTSW 10 23123851 critical splice donor site probably null
R7791:Eya4 UTSW 10 23113926 missense probably damaging 1.00
R7793:Eya4 UTSW 10 23226816 missense probably benign
Z1088:Eya4 UTSW 10 23113988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTCCCAAATTATCTGGATATGG -3'
(R):5'- CCTGCCATTTCAGAGAGTGTC -3'

Sequencing Primer
(F):5'- ACGCACACACATATATATGTATACAC -3'
(R):5'- CTGTGGACAGATAGCACTCATTG -3'
Posted On2019-10-17