Incidental Mutation 'R7549:Ros1'
ID 584403
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene Name Ros1 proto-oncogene
Synonyms Ros-1, c-ros
MMRRC Submission 045620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R7549 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51921817-52071340 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 52021930 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 639 (T639I)
Ref Sequence ENSEMBL: ENSMUSP00000020045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
AlphaFold Q78DX7
Predicted Effect probably damaging
Transcript: ENSMUST00000020045
AA Change: T639I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: T639I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218452
AA Change: T618I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219173
AA Change: T618I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,742,978 (GRCm39) R92S unknown Het
Adam1b A G 5: 121,639,981 (GRCm39) C355R probably damaging Het
Adamtsl3 T C 7: 82,223,117 (GRCm39) L966P probably damaging Het
Aldh18a1 A G 19: 40,553,291 (GRCm39) C486R probably damaging Het
Aqp11 C A 7: 97,387,284 (GRCm39) probably benign Het
Arhgap28 A G 17: 68,178,961 (GRCm39) L350P probably damaging Het
Art3 A G 5: 92,551,514 (GRCm39) Q291R probably benign Het
Asb15 A G 6: 24,559,029 (GRCm39) probably null Het
Bmp8b T C 4: 122,999,448 (GRCm39) I102T possibly damaging Het
Bsn T C 9: 107,992,014 (GRCm39) D1246G probably benign Het
Cass4 G A 2: 172,268,718 (GRCm39) G267S probably benign Het
Cass4 G T 2: 172,268,719 (GRCm39) G267V probably benign Het
Ccr7 T C 11: 99,036,727 (GRCm39) Y65C probably damaging Het
Clstn2 A C 9: 97,464,597 (GRCm39) I186S probably benign Het
Cyp2r1 A G 7: 114,153,879 (GRCm39) I105T possibly damaging Het
Efr3a T A 15: 65,687,262 (GRCm39) probably null Het
Erg A C 16: 95,170,179 (GRCm39) probably null Het
Eya4 A T 10: 22,987,557 (GRCm39) V524E probably damaging Het
Farp1 C A 14: 121,472,589 (GRCm39) N241K possibly damaging Het
Fat1 A T 8: 45,442,031 (GRCm39) Y1111F probably benign Het
Fbn1 T C 2: 125,185,947 (GRCm39) E1607G probably damaging Het
Fbn2 A T 18: 58,153,536 (GRCm39) C2575* probably null Het
Fsip2 A T 2: 82,824,337 (GRCm39) D6690V probably damaging Het
Fzd4 T C 7: 89,056,346 (GRCm39) V131A possibly damaging Het
Gfral T A 9: 76,106,257 (GRCm39) N110I probably benign Het
Glce T C 9: 61,968,275 (GRCm39) D292G probably damaging Het
Gm19410 T A 8: 36,266,500 (GRCm39) I1051K probably benign Het
Gm5773 A T 3: 93,680,323 (GRCm39) probably benign Het
Hcn3 A T 3: 89,057,307 (GRCm39) H430Q probably null Het
Hspa8 T A 9: 40,714,255 (GRCm39) probably null Het
Ifna7 A T 4: 88,734,664 (GRCm39) D67V possibly damaging Het
Kif5c T A 2: 49,591,105 (GRCm39) M319K probably benign Het
Klk7 G T 7: 43,462,197 (GRCm39) probably null Het
Kmt2c T C 5: 25,619,968 (GRCm39) K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrp1b C T 2: 40,765,134 (GRCm39) M2897I Het
Lysmd2 T C 9: 75,544,519 (GRCm39) S211P probably damaging Het
Magi1 T G 6: 93,685,095 (GRCm39) E761A probably benign Het
Mbd5 T A 2: 49,141,355 (GRCm39) I106N probably damaging Het
Mdc1 G A 17: 36,159,749 (GRCm39) A669T probably null Het
Mmp1b A G 9: 7,384,753 (GRCm39) I265T probably benign Het
Mmp2 T A 8: 93,563,594 (GRCm39) L356Q probably null Het
Mroh8 A G 2: 157,111,492 (GRCm39) L154P probably benign Het
Muc13 T C 16: 33,619,806 (GRCm39) S185P unknown Het
Nuak1 T A 10: 84,210,403 (GRCm39) I562F probably benign Het
Obscn C A 11: 58,933,664 (GRCm39) probably null Het
Or51t4 T C 7: 102,597,798 (GRCm39) I42T possibly damaging Het
Or5w14 A T 2: 87,542,115 (GRCm39) M45K probably damaging Het
Or9k7 T C 10: 130,046,853 (GRCm39) M49V probably benign Het
Pex3 T C 10: 13,418,414 (GRCm39) M81V probably benign Het
Pex5l T A 3: 33,136,184 (GRCm39) I12F probably benign Het
Phf3 G T 1: 30,870,556 (GRCm39) T164N probably benign Het
Phpt1 G T 2: 25,464,844 (GRCm39) A3E probably benign Het
Pja2 A T 17: 64,616,410 (GRCm39) L162M probably damaging Het
Pkdrej T A 15: 85,703,994 (GRCm39) K647N probably damaging Het
Ppp2r1a T C 17: 21,182,944 (GRCm39) S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 (GRCm39) D473Y probably damaging Het
Prl6a1 A T 13: 27,502,954 (GRCm39) E183D probably damaging Het
Psmd3 C T 11: 98,581,787 (GRCm39) T304M probably benign Het
Ptpn5 C T 7: 46,735,874 (GRCm39) probably null Het
Rassf6 T G 5: 90,754,661 (GRCm39) I206L probably damaging Het
Rif1 A G 2: 51,968,519 (GRCm39) H234R possibly damaging Het
Rint1 T C 5: 24,020,702 (GRCm39) V575A probably benign Het
Ryr2 A G 13: 11,752,871 (GRCm39) F1817L probably benign Het
Ska1 T C 18: 74,333,088 (GRCm39) D110G probably benign Het
Slc25a41 G A 17: 57,340,791 (GRCm39) T227I probably damaging Het
Slc6a15 T C 10: 103,224,998 (GRCm39) S29P probably benign Het
Slc8a3 A T 12: 81,361,544 (GRCm39) I425K probably benign Het
Sox8 T A 17: 25,786,935 (GRCm39) Q256L probably damaging Het
Tars3 T C 7: 65,297,341 (GRCm39) V152A probably damaging Het
Tbx10 A T 19: 4,046,651 (GRCm39) T44S probably benign Het
Terb1 T A 8: 105,224,716 (GRCm39) I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,740 (GRCm39) probably null Het
Tgm1 A G 14: 55,943,360 (GRCm39) V527A probably benign Het
Tmed10 G T 12: 85,391,036 (GRCm39) Y167* probably null Het
Tmem165 T G 5: 76,356,415 (GRCm39) S318R possibly damaging Het
Trim9 G T 12: 70,393,715 (GRCm39) S76R probably damaging Het
Tti1 A G 2: 157,849,088 (GRCm39) V717A probably damaging Het
Vmn2r86 T A 10: 130,282,697 (GRCm39) I640F probably damaging Het
Vwf A G 6: 125,603,230 (GRCm39) N860S Het
Xirp2 A G 2: 67,339,241 (GRCm39) K494R possibly damaging Het
Zkscan4 G A 13: 21,668,419 (GRCm39) S319N probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52,070,986 (GRCm39) missense probably benign 0.01
IGL00338:Ros1 APN 10 52,001,907 (GRCm39) missense probably benign
IGL00419:Ros1 APN 10 51,967,150 (GRCm39) missense probably damaging 0.97
IGL00840:Ros1 APN 10 52,020,969 (GRCm39) missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52,020,969 (GRCm39) missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52,019,348 (GRCm39) missense probably damaging 0.99
IGL01123:Ros1 APN 10 51,996,905 (GRCm39) missense probably damaging 1.00
IGL01128:Ros1 APN 10 52,018,424 (GRCm39) nonsense probably null
IGL01300:Ros1 APN 10 51,977,809 (GRCm39) missense probably benign 0.01
IGL01316:Ros1 APN 10 51,963,975 (GRCm39) critical splice donor site probably null
IGL01349:Ros1 APN 10 51,927,122 (GRCm39) missense probably damaging 0.99
IGL01363:Ros1 APN 10 52,042,238 (GRCm39) missense probably damaging 1.00
IGL01457:Ros1 APN 10 51,922,426 (GRCm39) splice site probably benign
IGL01532:Ros1 APN 10 51,967,034 (GRCm39) splice site probably benign
IGL01585:Ros1 APN 10 52,031,198 (GRCm39) missense probably damaging 1.00
IGL01650:Ros1 APN 10 52,031,075 (GRCm39) missense probably damaging 0.99
IGL01672:Ros1 APN 10 51,977,899 (GRCm39) missense possibly damaging 0.92
IGL01904:Ros1 APN 10 51,954,007 (GRCm39) missense probably damaging 0.97
IGL02040:Ros1 APN 10 51,992,018 (GRCm39) missense probably damaging 0.99
IGL02053:Ros1 APN 10 52,038,816 (GRCm39) missense probably damaging 1.00
IGL02147:Ros1 APN 10 51,996,991 (GRCm39) missense probably damaging 1.00
IGL02169:Ros1 APN 10 51,958,053 (GRCm39) critical splice donor site probably null
IGL02247:Ros1 APN 10 52,005,677 (GRCm39) missense probably damaging 0.99
IGL02262:Ros1 APN 10 52,055,065 (GRCm39) missense probably damaging 0.96
IGL02307:Ros1 APN 10 52,004,534 (GRCm39) missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52,020,980 (GRCm39) splice site probably benign
IGL02525:Ros1 APN 10 51,992,138 (GRCm39) missense possibly damaging 0.66
IGL02718:Ros1 APN 10 51,994,328 (GRCm39) missense probably damaging 1.00
IGL02721:Ros1 APN 10 52,048,927 (GRCm39) splice site probably benign
IGL02808:Ros1 APN 10 52,001,985 (GRCm39) missense probably damaging 1.00
IGL03009:Ros1 APN 10 52,022,003 (GRCm39) missense probably benign 0.00
IGL03035:Ros1 APN 10 51,952,080 (GRCm39) splice site probably benign
IGL03092:Ros1 APN 10 51,974,902 (GRCm39) missense probably damaging 0.99
IGL03309:Ros1 APN 10 51,994,357 (GRCm39) missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52,031,267 (GRCm39) missense probably damaging 1.00
boss UTSW 10 51,967,091 (GRCm39) nonsense probably null
Chuckwagon UTSW 10 51,994,299 (GRCm39) missense probably damaging 1.00
R1005_Ros1_648 UTSW 10 52,004,501 (GRCm39) splice site probably benign
R1220_Ros1_012 UTSW 10 51,974,966 (GRCm39) missense probably damaging 0.97
R3423_Ros1_122 UTSW 10 52,004,512 (GRCm39) splice site probably null
trail UTSW 10 52,037,991 (GRCm39) nonsense probably null
R0049:Ros1 UTSW 10 51,977,857 (GRCm39) missense possibly damaging 0.66
R0049:Ros1 UTSW 10 51,977,857 (GRCm39) missense possibly damaging 0.66
R0050:Ros1 UTSW 10 51,977,899 (GRCm39) missense probably damaging 0.97
R0050:Ros1 UTSW 10 51,977,899 (GRCm39) missense probably damaging 0.97
R0057:Ros1 UTSW 10 52,056,287 (GRCm39) missense probably benign 0.00
R0057:Ros1 UTSW 10 52,056,287 (GRCm39) missense probably benign 0.00
R0106:Ros1 UTSW 10 52,018,363 (GRCm39) missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52,018,363 (GRCm39) missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52,001,885 (GRCm39) missense probably benign 0.38
R0403:Ros1 UTSW 10 52,019,534 (GRCm39) splice site probably benign
R0487:Ros1 UTSW 10 52,031,204 (GRCm39) missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52,070,919 (GRCm39) splice site probably benign
R0557:Ros1 UTSW 10 51,961,359 (GRCm39) missense possibly damaging 0.82
R0599:Ros1 UTSW 10 51,999,396 (GRCm39) missense probably damaging 1.00
R0620:Ros1 UTSW 10 51,994,444 (GRCm39) missense probably damaging 1.00
R0679:Ros1 UTSW 10 51,942,391 (GRCm39) missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52,004,501 (GRCm39) splice site probably benign
R1073:Ros1 UTSW 10 51,922,221 (GRCm39) missense probably damaging 1.00
R1220:Ros1 UTSW 10 51,974,966 (GRCm39) missense probably damaging 0.97
R1279:Ros1 UTSW 10 52,018,262 (GRCm39) missense possibly damaging 0.81
R1295:Ros1 UTSW 10 51,964,028 (GRCm39) missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52,044,758 (GRCm39) missense probably damaging 1.00
R1371:Ros1 UTSW 10 51,964,041 (GRCm39) missense probably damaging 0.98
R1447:Ros1 UTSW 10 51,974,954 (GRCm39) missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52,048,954 (GRCm39) missense probably damaging 1.00
R1499:Ros1 UTSW 10 51,974,773 (GRCm39) missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52,037,907 (GRCm39) missense probably damaging 1.00
R1744:Ros1 UTSW 10 51,999,475 (GRCm39) missense probably damaging 0.99
R1759:Ros1 UTSW 10 51,996,922 (GRCm39) missense probably damaging 1.00
R1791:Ros1 UTSW 10 51,976,183 (GRCm39) missense probably benign 0.00
R1794:Ros1 UTSW 10 52,000,199 (GRCm39) nonsense probably null
R2031:Ros1 UTSW 10 51,943,164 (GRCm39) missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52,004,651 (GRCm39) missense probably benign 0.00
R2219:Ros1 UTSW 10 52,042,175 (GRCm39) missense probably damaging 1.00
R2290:Ros1 UTSW 10 51,994,477 (GRCm39) missense probably damaging 0.96
R2329:Ros1 UTSW 10 52,038,983 (GRCm39) missense probably damaging 1.00
R2371:Ros1 UTSW 10 52,039,991 (GRCm39) missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52,048,936 (GRCm39) critical splice donor site probably null
R3154:Ros1 UTSW 10 51,927,077 (GRCm39) missense probably benign
R3423:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3424:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3425:Ros1 UTSW 10 52,004,512 (GRCm39) splice site probably null
R3433:Ros1 UTSW 10 51,967,204 (GRCm39) missense probably benign 0.45
R3522:Ros1 UTSW 10 51,967,091 (GRCm39) nonsense probably null
R3686:Ros1 UTSW 10 52,021,912 (GRCm39) missense probably damaging 1.00
R3710:Ros1 UTSW 10 52,037,991 (GRCm39) nonsense probably null
R3771:Ros1 UTSW 10 52,005,087 (GRCm39) missense probably damaging 0.97
R3808:Ros1 UTSW 10 51,996,944 (GRCm39) missense probably benign 0.08
R3930:Ros1 UTSW 10 52,070,944 (GRCm39) missense possibly damaging 0.92
R3950:Ros1 UTSW 10 51,942,484 (GRCm39) missense probably damaging 1.00
R3981:Ros1 UTSW 10 51,996,974 (GRCm39) missense possibly damaging 0.46
R4007:Ros1 UTSW 10 51,994,328 (GRCm39) missense probably damaging 1.00
R4346:Ros1 UTSW 10 52,044,705 (GRCm39) missense possibly damaging 0.92
R4382:Ros1 UTSW 10 51,997,055 (GRCm39) missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52,038,800 (GRCm39) critical splice donor site probably null
R4450:Ros1 UTSW 10 51,954,038 (GRCm39) missense probably damaging 0.98
R4468:Ros1 UTSW 10 51,994,452 (GRCm39) missense probably damaging 1.00
R4569:Ros1 UTSW 10 52,040,090 (GRCm39) missense probably damaging 0.99
R4649:Ros1 UTSW 10 52,005,764 (GRCm39) missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52,005,192 (GRCm39) missense probably damaging 1.00
R4706:Ros1 UTSW 10 51,977,990 (GRCm39) missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52,018,325 (GRCm39) missense probably damaging 1.00
R4748:Ros1 UTSW 10 51,992,093 (GRCm39) missense probably benign 0.00
R4806:Ros1 UTSW 10 51,972,271 (GRCm39) missense probably damaging 0.96
R4865:Ros1 UTSW 10 52,048,966 (GRCm39) missense probably damaging 0.99
R4973:Ros1 UTSW 10 52,031,087 (GRCm39) missense probably damaging 0.98
R5022:Ros1 UTSW 10 52,000,171 (GRCm39) missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52,004,512 (GRCm39) critical splice donor site probably null
R5082:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52,040,037 (GRCm39) missense possibly damaging 0.66
R5269:Ros1 UTSW 10 51,927,104 (GRCm39) missense probably damaging 1.00
R5399:Ros1 UTSW 10 51,967,040 (GRCm39) critical splice donor site probably null
R5414:Ros1 UTSW 10 52,031,189 (GRCm39) missense probably damaging 1.00
R5659:Ros1 UTSW 10 52,019,482 (GRCm39) missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52,018,234 (GRCm39) critical splice donor site probably null
R5780:Ros1 UTSW 10 52,070,953 (GRCm39) missense probably damaging 1.00
R5805:Ros1 UTSW 10 51,999,385 (GRCm39) missense probably damaging 1.00
R5843:Ros1 UTSW 10 52,042,293 (GRCm39) missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52,057,894 (GRCm39) missense probably benign 0.26
R6027:Ros1 UTSW 10 52,040,064 (GRCm39) missense possibly damaging 0.82
R6035:Ros1 UTSW 10 51,954,067 (GRCm39) missense probably benign
R6035:Ros1 UTSW 10 51,954,067 (GRCm39) missense probably benign
R6052:Ros1 UTSW 10 52,039,999 (GRCm39) missense probably benign 0.39
R6175:Ros1 UTSW 10 51,977,881 (GRCm39) missense probably benign 0.02
R6315:Ros1 UTSW 10 51,994,306 (GRCm39) missense probably benign
R6342:Ros1 UTSW 10 52,031,351 (GRCm39) missense probably damaging 1.00
R6470:Ros1 UTSW 10 52,042,140 (GRCm39) critical splice donor site probably null
R6527:Ros1 UTSW 10 52,019,473 (GRCm39) missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52,038,908 (GRCm39) missense probably damaging 1.00
R6573:Ros1 UTSW 10 52,031,106 (GRCm39) missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52,018,299 (GRCm39) missense probably damaging 1.00
R6959:Ros1 UTSW 10 52,040,090 (GRCm39) missense probably damaging 0.99
R7011:Ros1 UTSW 10 52,056,272 (GRCm39) missense probably damaging 1.00
R7111:Ros1 UTSW 10 52,057,906 (GRCm39) missense probably benign 0.02
R7243:Ros1 UTSW 10 51,999,477 (GRCm39) missense probably damaging 1.00
R7355:Ros1 UTSW 10 52,042,175 (GRCm39) missense probably damaging 1.00
R7385:Ros1 UTSW 10 52,031,222 (GRCm39) missense probably benign 0.00
R7460:Ros1 UTSW 10 51,994,299 (GRCm39) missense probably damaging 1.00
R7573:Ros1 UTSW 10 52,046,072 (GRCm39) missense probably benign 0.03
R7650:Ros1 UTSW 10 51,922,305 (GRCm39) missense probably benign 0.00
R7667:Ros1 UTSW 10 52,040,067 (GRCm39) missense probably damaging 1.00
R7696:Ros1 UTSW 10 52,018,379 (GRCm39) missense probably damaging 1.00
R7785:Ros1 UTSW 10 52,038,944 (GRCm39) missense probably damaging 1.00
R7814:Ros1 UTSW 10 51,972,233 (GRCm39) missense probably benign 0.28
R7830:Ros1 UTSW 10 52,031,030 (GRCm39) missense probably damaging 0.99
R7832:Ros1 UTSW 10 52,020,957 (GRCm39) missense probably damaging 0.99
R7854:Ros1 UTSW 10 52,004,563 (GRCm39) missense probably damaging 1.00
R7912:Ros1 UTSW 10 52,044,791 (GRCm39) missense probably damaging 1.00
R7972:Ros1 UTSW 10 52,030,926 (GRCm39) nonsense probably null
R7993:Ros1 UTSW 10 51,999,443 (GRCm39) missense probably benign 0.34
R8036:Ros1 UTSW 10 52,041,439 (GRCm39) missense probably benign
R8137:Ros1 UTSW 10 52,001,933 (GRCm39) missense possibly damaging 0.87
R8169:Ros1 UTSW 10 51,940,768 (GRCm39) critical splice donor site probably null
R8199:Ros1 UTSW 10 51,977,813 (GRCm39) nonsense probably null
R8293:Ros1 UTSW 10 51,964,014 (GRCm39) missense probably damaging 1.00
R8368:Ros1 UTSW 10 51,940,833 (GRCm39) missense probably damaging 1.00
R8406:Ros1 UTSW 10 51,977,941 (GRCm39) missense possibly damaging 0.56
R8471:Ros1 UTSW 10 51,997,078 (GRCm39) missense probably benign 0.00
R8498:Ros1 UTSW 10 52,055,047 (GRCm39) missense probably damaging 0.99
R8532:Ros1 UTSW 10 51,974,852 (GRCm39) missense possibly damaging 0.92
R8678:Ros1 UTSW 10 51,963,998 (GRCm39) missense probably benign
R8726:Ros1 UTSW 10 51,954,769 (GRCm39) missense possibly damaging 0.46
R8789:Ros1 UTSW 10 51,999,328 (GRCm39) missense probably damaging 0.99
R8799:Ros1 UTSW 10 51,922,143 (GRCm39) missense probably benign 0.08
R8915:Ros1 UTSW 10 51,977,805 (GRCm39) splice site probably benign
R8958:Ros1 UTSW 10 51,972,190 (GRCm39) missense probably damaging 1.00
R8972:Ros1 UTSW 10 51,999,333 (GRCm39) missense probably benign 0.05
R9020:Ros1 UTSW 10 52,031,023 (GRCm39) missense probably benign 0.32
R9147:Ros1 UTSW 10 51,927,039 (GRCm39) missense probably benign
R9154:Ros1 UTSW 10 51,922,301 (GRCm39) missense possibly damaging 0.87
R9189:Ros1 UTSW 10 52,019,502 (GRCm39) missense probably damaging 0.99
R9341:Ros1 UTSW 10 51,972,116 (GRCm39) critical splice donor site probably null
R9343:Ros1 UTSW 10 51,972,116 (GRCm39) critical splice donor site probably null
R9407:Ros1 UTSW 10 51,994,491 (GRCm39) missense probably damaging 1.00
R9428:Ros1 UTSW 10 51,958,061 (GRCm39) missense probably benign 0.00
R9502:Ros1 UTSW 10 52,000,174 (GRCm39) missense probably benign 0.00
R9531:Ros1 UTSW 10 52,007,063 (GRCm39) missense probably damaging 1.00
R9546:Ros1 UTSW 10 51,994,215 (GRCm39) critical splice donor site probably null
R9562:Ros1 UTSW 10 51,943,170 (GRCm39) missense probably damaging 1.00
R9565:Ros1 UTSW 10 51,943,170 (GRCm39) missense probably damaging 1.00
R9604:Ros1 UTSW 10 51,994,249 (GRCm39) missense probably damaging 1.00
R9645:Ros1 UTSW 10 51,948,148 (GRCm39) critical splice donor site probably null
R9658:Ros1 UTSW 10 51,967,069 (GRCm39) missense probably damaging 0.99
R9664:Ros1 UTSW 10 51,996,931 (GRCm39) missense probably benign 0.18
RF018:Ros1 UTSW 10 52,031,217 (GRCm39) missense probably benign
Z1176:Ros1 UTSW 10 51,967,205 (GRCm39) missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52,044,767 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGCTCTCAGACTGAAGATTC -3'
(R):5'- GAGACTTCCTTGGTCTGTCC -3'

Sequencing Primer
(F):5'- GCTCTCAGACTGAAGATTCACCCTC -3'
(R):5'- CTTATGGTGCTGTTCTGGACAATGAC -3'
Posted On 2019-10-17