Incidental Mutation 'R7549:Nuak1'
ID584404
Institutional Source Beutler Lab
Gene Symbol Nuak1
Ensembl Gene ENSMUSG00000020032
Gene NameNUAK family, SNF1-like kinase, 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7549 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location84370905-84440597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84374539 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 562 (I562F)
Ref Sequence ENSEMBL: ENSMUSP00000020220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020220]
Predicted Effect probably benign
Transcript: ENSMUST00000020220
AA Change: I562F

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020220
Gene: ENSMUSG00000020032
AA Change: I562F

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
S_TKc 56 307 2.3e-105 SMART
low complexity region 475 490 N/A INTRINSIC
low complexity region 559 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129355
SMART Domains Protein: ENSMUSP00000122927
Gene: ENSMUSG00000020032

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 156 3.1e-19 PFAM
Pfam:Pkinase 19 158 3.5e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene die perinatally displaying omphalocele with a failure in closure of the secondary body wall. No gross morphological defects are detected in brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adam1b A G 5: 121,501,918 C355R probably damaging Het
Adamtsl3 T C 7: 82,573,909 L966P probably damaging Het
Aldh18a1 A G 19: 40,564,847 C486R probably damaging Het
Aqp11 C A 7: 97,738,077 probably benign Het
Arhgap28 A G 17: 67,871,966 L350P probably damaging Het
Art3 A G 5: 92,403,655 Q291R probably benign Het
Asb15 A G 6: 24,559,030 probably null Het
Bmp8b T C 4: 123,105,655 I102T possibly damaging Het
Bsn T C 9: 108,114,815 D1246G probably benign Het
Cass4 G A 2: 172,426,798 G267S probably benign Het
Cass4 G T 2: 172,426,799 G267V probably benign Het
Ccr7 T C 11: 99,145,901 Y65C probably damaging Het
Clstn2 A C 9: 97,582,544 I186S probably benign Het
Cyp2r1 A G 7: 114,554,644 I105T possibly damaging Het
Efr3a T A 15: 65,815,413 probably null Het
Erg A C 16: 95,369,320 probably null Het
Eya4 A T 10: 23,111,658 V524E probably damaging Het
Farp1 C A 14: 121,235,177 N241K possibly damaging Het
Fat1 A T 8: 44,988,994 Y1111F probably benign Het
Fbn1 T C 2: 125,344,027 E1607G probably damaging Het
Fbn2 A T 18: 58,020,464 C2575* probably null Het
Fsip2 A T 2: 82,993,993 D6690V probably damaging Het
Fzd4 T C 7: 89,407,138 V131A possibly damaging Het
Gfral T A 9: 76,198,975 N110I probably benign Het
Glce T C 9: 62,060,993 D292G probably damaging Het
Gm19410 T A 8: 35,799,346 I1051K probably benign Het
Gm5773 A T 3: 93,773,016 probably benign Het
Hcn3 A T 3: 89,150,000 H430Q probably null Het
Hspa8 T A 9: 40,802,959 probably null Het
Ifna7 A T 4: 88,816,427 D67V possibly damaging Het
Kif5c T A 2: 49,701,093 M319K probably benign Het
Klk7 G T 7: 43,812,773 probably null Het
Kmt2c T C 5: 25,414,970 K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b C T 2: 40,875,122 M2897I Het
Lysmd2 T C 9: 75,637,237 S211P probably damaging Het
Magi1 T G 6: 93,708,114 E761A probably benign Het
Mbd5 T A 2: 49,251,343 I106N probably damaging Het
Mdc1 G A 17: 35,848,857 A669T probably null Het
Mmp1b A G 9: 7,384,753 I265T probably benign Het
Mmp2 T A 8: 92,836,966 L356Q probably null Het
Mroh8 A G 2: 157,269,572 L154P probably benign Het
Muc13 T C 16: 33,799,436 S185P unknown Het
Obscn C A 11: 59,042,838 probably null Het
Olfr1137 A T 2: 87,711,771 M45K probably damaging Het
Olfr574 T C 7: 102,948,591 I42T possibly damaging Het
Olfr827 T C 10: 130,210,984 M49V probably benign Het
Pex3 T C 10: 13,542,670 M81V probably benign Het
Pex5l T A 3: 33,082,035 I12F probably benign Het
Phf3 G T 1: 30,831,475 T164N probably benign Het
Phpt1 G T 2: 25,574,832 A3E probably benign Het
Pja2 A T 17: 64,309,415 L162M probably damaging Het
Pkdrej T A 15: 85,819,793 K647N probably damaging Het
Ppp2r1a T C 17: 20,962,682 S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 D473Y probably damaging Het
Prl6a1 A T 13: 27,318,971 E183D probably damaging Het
Psmd3 C T 11: 98,690,961 T304M probably benign Het
Ptpn5 C T 7: 47,086,126 probably null Het
Rassf6 T G 5: 90,606,802 I206L probably damaging Het
Rif1 A G 2: 52,078,507 H234R possibly damaging Het
Rint1 T C 5: 23,815,704 V575A probably benign Het
Ros1 G A 10: 52,145,834 T639I probably damaging Het
Ryr2 A G 13: 11,737,985 F1817L probably benign Het
Ska1 T C 18: 74,200,017 D110G probably benign Het
Slc25a41 G A 17: 57,033,791 T227I probably damaging Het
Slc6a15 T C 10: 103,389,137 S29P probably benign Het
Slc8a3 A T 12: 81,314,770 I425K probably benign Het
Sox8 T A 17: 25,567,961 Q256L probably damaging Het
Tarsl2 T C 7: 65,647,593 V152A probably damaging Het
Tbx10 A T 19: 3,996,651 T44S probably benign Het
Terb1 T A 8: 104,498,084 I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,741 probably null Het
Tgm1 A G 14: 55,705,903 V527A probably benign Het
Tmed10 G T 12: 85,344,262 Y167* probably null Het
Tmem165 T G 5: 76,208,568 S318R possibly damaging Het
Trim9 G T 12: 70,346,941 S76R probably damaging Het
Tti1 A G 2: 158,007,168 V717A probably damaging Het
Vmn2r86 T A 10: 130,446,828 I640F probably damaging Het
Vwf A G 6: 125,626,267 N860S Het
Xirp2 A G 2: 67,508,897 K494R possibly damaging Het
Zkscan4 G A 13: 21,484,249 S319N probably damaging Het
Other mutations in Nuak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nuak1 APN 10 84375134 missense probably damaging 1.00
IGL01374:Nuak1 APN 10 84374668 missense probably damaging 0.96
IGL02967:Nuak1 APN 10 84440221 missense probably damaging 1.00
IGL03207:Nuak1 APN 10 84440129 missense possibly damaging 0.84
R0002:Nuak1 UTSW 10 84375367 missense probably damaging 1.00
R0277:Nuak1 UTSW 10 84374451 missense probably benign 0.02
R0749:Nuak1 UTSW 10 84374784 missense probably damaging 1.00
R0906:Nuak1 UTSW 10 84375280 missense probably damaging 1.00
R1227:Nuak1 UTSW 10 84440309 missense probably benign
R1367:Nuak1 UTSW 10 84392328 splice site probably benign
R1778:Nuak1 UTSW 10 84374874 unclassified probably null
R2151:Nuak1 UTSW 10 84409645 missense probably benign 0.00
R2877:Nuak1 UTSW 10 84375345 missense possibly damaging 0.79
R3863:Nuak1 UTSW 10 84378087 splice site probably null
R4386:Nuak1 UTSW 10 84394044 missense probably damaging 1.00
R4849:Nuak1 UTSW 10 84375279 missense probably damaging 1.00
R4962:Nuak1 UTSW 10 84375115 missense probably damaging 1.00
R5118:Nuak1 UTSW 10 84374984 missense probably benign 0.04
R5134:Nuak1 UTSW 10 84374350 missense probably benign 0.01
R5248:Nuak1 UTSW 10 84409678 missense probably damaging 1.00
R5590:Nuak1 UTSW 10 84375255 missense probably benign
R5719:Nuak1 UTSW 10 84409720 missense probably damaging 1.00
R5933:Nuak1 UTSW 10 84374802 missense probably damaging 0.99
R7067:Nuak1 UTSW 10 84440294 missense possibly damaging 0.59
R7169:Nuak1 UTSW 10 84374745 missense probably damaging 1.00
R7342:Nuak1 UTSW 10 84374967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTGTCTCAAAGTCCTGAAG -3'
(R):5'- TATTCATCCCCAGAGCGCAG -3'

Sequencing Primer
(F):5'- TGTCTCAAAGTCCTGAAGCTGGAG -3'
(R):5'- ACAGCAACGATGTGGTCATC -3'
Posted On2019-10-17