Incidental Mutation 'R7549:Ccr7'
ID 584410
Institutional Source Beutler Lab
Gene Symbol Ccr7
Ensembl Gene ENSMUSG00000037944
Gene Name chemokine (C-C motif) receptor 7
Synonyms EBI1, Ebi1h, Cmkbr7, CD197
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock # R7549 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 99144196-99155077 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99145901 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 65 (Y65C)
Ref Sequence ENSEMBL: ENSMUSP00000099423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103134]
AlphaFold P47774
Predicted Effect probably damaging
Transcript: ENSMUST00000103134
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099423
Gene: ENSMUSG00000037944
AA Change: Y65C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:7tm_1 75 326 1.8e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G protein-coupled receptor family. This receptor was identified as a gene induced by the Epstein-Barr virus (EBV), and is thought to be a mediator of EBV effects on B lymphocytes. This receptor is expressed in various lymphoid tissues and activates B and T lymphocytes. It has been shown to control the migration of memory T cells to inflamed tissues, as well as stimulate dendritic cell maturation. The chemokine (C-C motif) ligand 19 (CCL19/ECL) has been reported to be a specific ligand of this receptor. Signals mediated by this receptor regulate T cell homeostasis in lymph nodes, and may also function in the activation and polarization of T cells, and in chronic inflammation pathogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice exhibit an impaired primary immune response. Dendritic cells, B, T and T regulatory cells show impaired migration to the lymph nodes and secondary lymph organs exhibit morphological abnormalities. Lymphocytic infiltrates to the pancreas, lung and stomach are observed in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adam1b A G 5: 121,501,918 C355R probably damaging Het
Adamtsl3 T C 7: 82,573,909 L966P probably damaging Het
Aldh18a1 A G 19: 40,564,847 C486R probably damaging Het
Aqp11 C A 7: 97,738,077 probably benign Het
Arhgap28 A G 17: 67,871,966 L350P probably damaging Het
Art3 A G 5: 92,403,655 Q291R probably benign Het
Asb15 A G 6: 24,559,030 probably null Het
Bmp8b T C 4: 123,105,655 I102T possibly damaging Het
Bsn T C 9: 108,114,815 D1246G probably benign Het
Cass4 G A 2: 172,426,798 G267S probably benign Het
Cass4 G T 2: 172,426,799 G267V probably benign Het
Clstn2 A C 9: 97,582,544 I186S probably benign Het
Cyp2r1 A G 7: 114,554,644 I105T possibly damaging Het
Efr3a T A 15: 65,815,413 probably null Het
Erg A C 16: 95,369,320 probably null Het
Eya4 A T 10: 23,111,658 V524E probably damaging Het
Farp1 C A 14: 121,235,177 N241K possibly damaging Het
Fat1 A T 8: 44,988,994 Y1111F probably benign Het
Fbn1 T C 2: 125,344,027 E1607G probably damaging Het
Fbn2 A T 18: 58,020,464 C2575* probably null Het
Fsip2 A T 2: 82,993,993 D6690V probably damaging Het
Fzd4 T C 7: 89,407,138 V131A possibly damaging Het
Gfral T A 9: 76,198,975 N110I probably benign Het
Glce T C 9: 62,060,993 D292G probably damaging Het
Gm19410 T A 8: 35,799,346 I1051K probably benign Het
Gm5773 A T 3: 93,773,016 probably benign Het
Hcn3 A T 3: 89,150,000 H430Q probably null Het
Hspa8 T A 9: 40,802,959 probably null Het
Ifna7 A T 4: 88,816,427 D67V possibly damaging Het
Kif5c T A 2: 49,701,093 M319K probably benign Het
Klk7 G T 7: 43,812,773 probably null Het
Kmt2c T C 5: 25,414,970 K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b C T 2: 40,875,122 M2897I Het
Lysmd2 T C 9: 75,637,237 S211P probably damaging Het
Magi1 T G 6: 93,708,114 E761A probably benign Het
Mbd5 T A 2: 49,251,343 I106N probably damaging Het
Mdc1 G A 17: 35,848,857 A669T probably null Het
Mmp1b A G 9: 7,384,753 I265T probably benign Het
Mmp2 T A 8: 92,836,966 L356Q probably null Het
Mroh8 A G 2: 157,269,572 L154P probably benign Het
Muc13 T C 16: 33,799,436 S185P unknown Het
Nuak1 T A 10: 84,374,539 I562F probably benign Het
Obscn C A 11: 59,042,838 probably null Het
Olfr1137 A T 2: 87,711,771 M45K probably damaging Het
Olfr574 T C 7: 102,948,591 I42T possibly damaging Het
Olfr827 T C 10: 130,210,984 M49V probably benign Het
Pex3 T C 10: 13,542,670 M81V probably benign Het
Pex5l T A 3: 33,082,035 I12F probably benign Het
Phf3 G T 1: 30,831,475 T164N probably benign Het
Phpt1 G T 2: 25,574,832 A3E probably benign Het
Pja2 A T 17: 64,309,415 L162M probably damaging Het
Pkdrej T A 15: 85,819,793 K647N probably damaging Het
Ppp2r1a T C 17: 20,962,682 S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 D473Y probably damaging Het
Prl6a1 A T 13: 27,318,971 E183D probably damaging Het
Psmd3 C T 11: 98,690,961 T304M probably benign Het
Ptpn5 C T 7: 47,086,126 probably null Het
Rassf6 T G 5: 90,606,802 I206L probably damaging Het
Rif1 A G 2: 52,078,507 H234R possibly damaging Het
Rint1 T C 5: 23,815,704 V575A probably benign Het
Ros1 G A 10: 52,145,834 T639I probably damaging Het
Ryr2 A G 13: 11,737,985 F1817L probably benign Het
Ska1 T C 18: 74,200,017 D110G probably benign Het
Slc25a41 G A 17: 57,033,791 T227I probably damaging Het
Slc6a15 T C 10: 103,389,137 S29P probably benign Het
Slc8a3 A T 12: 81,314,770 I425K probably benign Het
Sox8 T A 17: 25,567,961 Q256L probably damaging Het
Tarsl2 T C 7: 65,647,593 V152A probably damaging Het
Tbx10 A T 19: 3,996,651 T44S probably benign Het
Terb1 T A 8: 104,498,084 I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,741 probably null Het
Tgm1 A G 14: 55,705,903 V527A probably benign Het
Tmed10 G T 12: 85,344,262 Y167* probably null Het
Tmem165 T G 5: 76,208,568 S318R possibly damaging Het
Trim9 G T 12: 70,346,941 S76R probably damaging Het
Tti1 A G 2: 158,007,168 V717A probably damaging Het
Vmn2r86 T A 10: 130,446,828 I640F probably damaging Het
Vwf A G 6: 125,626,267 N860S Het
Xirp2 A G 2: 67,508,897 K494R possibly damaging Het
Zkscan4 G A 13: 21,484,249 S319N probably damaging Het
Other mutations in Ccr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Ccr7 APN 11 99145145 missense probably benign 0.45
Kongtong UTSW 11 99145663 missense probably damaging 1.00
lanzhou UTSW 11 99145277 missense possibly damaging 0.90
qinghai UTSW 11 99145823 missense probably damaging 1.00
IGL03047:Ccr7 UTSW 11 99145334 missense probably benign 0.44
R0707:Ccr7 UTSW 11 99145983 missense probably damaging 1.00
R1115:Ccr7 UTSW 11 99145277 missense possibly damaging 0.90
R1664:Ccr7 UTSW 11 99145691 missense possibly damaging 0.90
R2291:Ccr7 UTSW 11 99145335 missense probably damaging 1.00
R3743:Ccr7 UTSW 11 99145207 missense possibly damaging 0.86
R4108:Ccr7 UTSW 11 99145378 missense probably damaging 1.00
R4214:Ccr7 UTSW 11 99145046 missense probably damaging 0.98
R5402:Ccr7 UTSW 11 99145734 missense possibly damaging 0.93
R5602:Ccr7 UTSW 11 99145489 missense probably benign 0.08
R6275:Ccr7 UTSW 11 99145663 missense probably damaging 1.00
R6991:Ccr7 UTSW 11 99145304 missense probably damaging 1.00
R7470:Ccr7 UTSW 11 99145557 missense possibly damaging 0.80
R8973:Ccr7 UTSW 11 99145823 missense probably damaging 1.00
R9117:Ccr7 UTSW 11 99145260 missense probably damaging 1.00
R9206:Ccr7 UTSW 11 99149069 missense probably benign
R9631:Ccr7 UTSW 11 99145790 missense probably benign 0.01
Z1176:Ccr7 UTSW 11 99144980 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAAAGATGCCCTTACAC -3'
(R):5'- ATGTCCTGACTGTGAGATCCG -3'

Sequencing Primer
(F):5'- GATGCCCTTACACAGGTAGACG -3'
(R):5'- AGATCCGGACTGTGAGCTCATC -3'
Posted On 2019-10-17