Mutagenetix > Incidental Mutation

Incidental Mutation 'R7549:Slc8a3'

584412

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7549 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81314770 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 425 (I425K)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: I425K

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000085238
AA Change: I425K

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: I425K

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182208
AA Change: I425K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: I425K

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530084C06Rik	G	T	13: 31,558,995	R92S	unknown	Het
Adam1b	A	G	5: 121,501,918	C355R	probably damaging	Het
Adamtsl3	T	C	7: 82,573,909	L966P	probably damaging	Het
Aldh18a1	A	G	19: 40,564,847	C486R	probably damaging	Het
Aqp11	C	A	7: 97,738,077		probably benign	Het
Arhgap28	A	G	17: 67,871,966	L350P	probably damaging	Het
Art3	A	G	5: 92,403,655	Q291R	probably benign	Het
Asb15	A	G	6: 24,559,030		probably null	Het
Bmp8b	T	C	4: 123,105,655	I102T	possibly damaging	Het
Bsn	T	C	9: 108,114,815	D1246G	probably benign	Het
Cass4	G	A	2: 172,426,798	G267S	probably benign	Het
Cass4	G	T	2: 172,426,799	G267V	probably benign	Het
Ccr7	T	C	11: 99,145,901	Y65C	probably damaging	Het
Clstn2	A	C	9: 97,582,544	I186S	probably benign	Het
Cyp2r1	A	G	7: 114,554,644	I105T	possibly damaging	Het
Efr3a	T	A	15: 65,815,413		probably null	Het
Erg	A	C	16: 95,369,320		probably null	Het
Eya4	A	T	10: 23,111,658	V524E	probably damaging	Het
Farp1	C	A	14: 121,235,177	N241K	possibly damaging	Het
Fat1	A	T	8: 44,988,994	Y1111F	probably benign	Het
Fbn1	T	C	2: 125,344,027	E1607G	probably damaging	Het
Fbn2	A	T	18: 58,020,464	C2575*	probably null	Het
Fsip2	A	T	2: 82,993,993	D6690V	probably damaging	Het
Fzd4	T	C	7: 89,407,138	V131A	possibly damaging	Het
Gfral	T	A	9: 76,198,975	N110I	probably benign	Het
Glce	T	C	9: 62,060,993	D292G	probably damaging	Het
Gm19410	T	A	8: 35,799,346	I1051K	probably benign	Het
Gm5773	A	T	3: 93,773,016		probably benign	Het
Hcn3	A	T	3: 89,150,000	H430Q	probably null	Het
Hspa8	T	A	9: 40,802,959		probably null	Het
Ifna7	A	T	4: 88,816,427	D67V	possibly damaging	Het
Kif5c	T	A	2: 49,701,093	M319K	probably benign	Het
Klk7	G	T	7: 43,812,773		probably null	Het
Kmt2c	T	C	5: 25,414,970	K102E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lrp1b	C	T	2: 40,875,122	M2897I		Het
Lysmd2	T	C	9: 75,637,237	S211P	probably damaging	Het
Magi1	T	G	6: 93,708,114	E761A	probably benign	Het
Mbd5	T	A	2: 49,251,343	I106N	probably damaging	Het
Mdc1	G	A	17: 35,848,857	A669T	probably null	Het
Mmp1b	A	G	9: 7,384,753	I265T	probably benign	Het
Mmp2	T	A	8: 92,836,966	L356Q	probably null	Het
Mroh8	A	G	2: 157,269,572	L154P	probably benign	Het
Muc13	T	C	16: 33,799,436	S185P	unknown	Het
Nuak1	T	A	10: 84,374,539	I562F	probably benign	Het
Obscn	C	A	11: 59,042,838		probably null	Het
Olfr1137	A	T	2: 87,711,771	M45K	probably damaging	Het
Olfr574	T	C	7: 102,948,591	I42T	possibly damaging	Het
Olfr827	T	C	10: 130,210,984	M49V	probably benign	Het
Pex3	T	C	10: 13,542,670	M81V	probably benign	Het
Pex5l	T	A	3: 33,082,035	I12F	probably benign	Het
Phf3	G	T	1: 30,831,475	T164N	probably benign	Het
Phpt1	G	T	2: 25,574,832	A3E	probably benign	Het
Pja2	A	T	17: 64,309,415	L162M	probably damaging	Het
Pkdrej	T	A	15: 85,819,793	K647N	probably damaging	Het
Ppp2r1a	T	C	17: 20,962,682	S543P	possibly damaging	Het
Prdm13	C	A	4: 21,679,072	D473Y	probably damaging	Het
Prl6a1	A	T	13: 27,318,971	E183D	probably damaging	Het
Psmd3	C	T	11: 98,690,961	T304M	probably benign	Het
Ptpn5	C	T	7: 47,086,126		probably null	Het
Rassf6	T	G	5: 90,606,802	I206L	probably damaging	Het
Rif1	A	G	2: 52,078,507	H234R	possibly damaging	Het
Rint1	T	C	5: 23,815,704	V575A	probably benign	Het
Ros1	G	A	10: 52,145,834	T639I	probably damaging	Het
Ryr2	A	G	13: 11,737,985	F1817L	probably benign	Het
Ska1	T	C	18: 74,200,017	D110G	probably benign	Het
Slc25a41	G	A	17: 57,033,791	T227I	probably damaging	Het
Slc6a15	T	C	10: 103,389,137	S29P	probably benign	Het
Sox8	T	A	17: 25,567,961	Q256L	probably damaging	Het
Tarsl2	T	C	7: 65,647,593	V152A	probably damaging	Het
Tbx10	A	T	19: 3,996,651	T44S	probably benign	Het
Terb1	T	A	8: 104,498,084	I52F	possibly damaging	Het
Tes	AGCCGGCC	AGCC	6: 17,099,741		probably null	Het
Tgm1	A	G	14: 55,705,903	V527A	probably benign	Het
Tmed10	G	T	12: 85,344,262	Y167*	probably null	Het
Tmem165	T	G	5: 76,208,568	S318R	possibly damaging	Het
Trim9	G	T	12: 70,346,941	S76R	probably damaging	Het
Tti1	A	G	2: 158,007,168	V717A	probably damaging	Het
Vmn2r86	T	A	10: 130,446,828	I640F	probably damaging	Het
Vwf	A	G	6: 125,626,267	N860S		Het
Xirp2	A	G	2: 67,508,897	K494R	possibly damaging	Het
Zkscan4	G	A	13: 21,484,249	S319N	probably damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CAGCCTCACAAAGAAGTGTTC -3'
(R):5'- TGCTTTCTACCGCATCCAAG -3'

Sequencing Primer
(F):5'- AGTGTTCATCCTCCTCAAAAATGTC -3'
(R):5'- CTGGTGCGGGCAATATACTTAAG -3'

Posted On

2019-10-17