Incidental Mutation 'R7549:Pkdrej'
ID584421
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7549 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85819793 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 647 (K647N)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: K647N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: K647N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adam1b A G 5: 121,501,918 C355R probably damaging Het
Adamtsl3 T C 7: 82,573,909 L966P probably damaging Het
Aldh18a1 A G 19: 40,564,847 C486R probably damaging Het
Aqp11 C A 7: 97,738,077 probably benign Het
Arhgap28 A G 17: 67,871,966 L350P probably damaging Het
Art3 A G 5: 92,403,655 Q291R probably benign Het
Asb15 A G 6: 24,559,030 probably null Het
Bmp8b T C 4: 123,105,655 I102T possibly damaging Het
Bsn T C 9: 108,114,815 D1246G probably benign Het
Cass4 G A 2: 172,426,798 G267S probably benign Het
Cass4 G T 2: 172,426,799 G267V probably benign Het
Ccr7 T C 11: 99,145,901 Y65C probably damaging Het
Clstn2 A C 9: 97,582,544 I186S probably benign Het
Cyp2r1 A G 7: 114,554,644 I105T possibly damaging Het
Efr3a T A 15: 65,815,413 probably null Het
Erg A C 16: 95,369,320 probably null Het
Eya4 A T 10: 23,111,658 V524E probably damaging Het
Farp1 C A 14: 121,235,177 N241K possibly damaging Het
Fat1 A T 8: 44,988,994 Y1111F probably benign Het
Fbn1 T C 2: 125,344,027 E1607G probably damaging Het
Fbn2 A T 18: 58,020,464 C2575* probably null Het
Fsip2 A T 2: 82,993,993 D6690V probably damaging Het
Fzd4 T C 7: 89,407,138 V131A possibly damaging Het
Gfral T A 9: 76,198,975 N110I probably benign Het
Glce T C 9: 62,060,993 D292G probably damaging Het
Gm19410 T A 8: 35,799,346 I1051K probably benign Het
Gm5773 A T 3: 93,773,016 probably benign Het
Hcn3 A T 3: 89,150,000 H430Q probably null Het
Hspa8 T A 9: 40,802,959 probably null Het
Ifna7 A T 4: 88,816,427 D67V possibly damaging Het
Kif5c T A 2: 49,701,093 M319K probably benign Het
Klk7 G T 7: 43,812,773 probably null Het
Kmt2c T C 5: 25,414,970 K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b C T 2: 40,875,122 M2897I Het
Lysmd2 T C 9: 75,637,237 S211P probably damaging Het
Magi1 T G 6: 93,708,114 E761A probably benign Het
Mbd5 T A 2: 49,251,343 I106N probably damaging Het
Mdc1 G A 17: 35,848,857 A669T probably null Het
Mmp1b A G 9: 7,384,753 I265T probably benign Het
Mmp2 T A 8: 92,836,966 L356Q probably null Het
Mroh8 A G 2: 157,269,572 L154P probably benign Het
Muc13 T C 16: 33,799,436 S185P unknown Het
Nuak1 T A 10: 84,374,539 I562F probably benign Het
Obscn C A 11: 59,042,838 probably null Het
Olfr1137 A T 2: 87,711,771 M45K probably damaging Het
Olfr574 T C 7: 102,948,591 I42T possibly damaging Het
Olfr827 T C 10: 130,210,984 M49V probably benign Het
Pex3 T C 10: 13,542,670 M81V probably benign Het
Pex5l T A 3: 33,082,035 I12F probably benign Het
Phf3 G T 1: 30,831,475 T164N probably benign Het
Phpt1 G T 2: 25,574,832 A3E probably benign Het
Pja2 A T 17: 64,309,415 L162M probably damaging Het
Ppp2r1a T C 17: 20,962,682 S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 D473Y probably damaging Het
Prl6a1 A T 13: 27,318,971 E183D probably damaging Het
Psmd3 C T 11: 98,690,961 T304M probably benign Het
Ptpn5 C T 7: 47,086,126 probably null Het
Rassf6 T G 5: 90,606,802 I206L probably damaging Het
Rif1 A G 2: 52,078,507 H234R possibly damaging Het
Rint1 T C 5: 23,815,704 V575A probably benign Het
Ros1 G A 10: 52,145,834 T639I probably damaging Het
Ryr2 A G 13: 11,737,985 F1817L probably benign Het
Ska1 T C 18: 74,200,017 D110G probably benign Het
Slc25a41 G A 17: 57,033,791 T227I probably damaging Het
Slc6a15 T C 10: 103,389,137 S29P probably benign Het
Slc8a3 A T 12: 81,314,770 I425K probably benign Het
Sox8 T A 17: 25,567,961 Q256L probably damaging Het
Tarsl2 T C 7: 65,647,593 V152A probably damaging Het
Tbx10 A T 19: 3,996,651 T44S probably benign Het
Terb1 T A 8: 104,498,084 I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,741 probably null Het
Tgm1 A G 14: 55,705,903 V527A probably benign Het
Tmed10 G T 12: 85,344,262 Y167* probably null Het
Tmem165 T G 5: 76,208,568 S318R possibly damaging Het
Trim9 G T 12: 70,346,941 S76R probably damaging Het
Tti1 A G 2: 158,007,168 V717A probably damaging Het
Vmn2r86 T A 10: 130,446,828 I640F probably damaging Het
Vwf A G 6: 125,626,267 N860S Het
Xirp2 A G 2: 67,508,897 K494R possibly damaging Het
Zkscan4 G A 13: 21,484,249 S319N probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ATCAGCTTAAGAAGGTTAGACAGACTG -3'
(R):5'- GTCACCATGAAACCGACGTC -3'

Sequencing Primer
(F):5'- TTAGACAGACTGGTTAGGATGCC -3'
(R):5'- TGAAACCGACGTCACTGTTG -3'
Posted On2019-10-17