Incidental Mutation 'R7549:Fbn2'
ID584431
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #R7549 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58020464 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 2575 (C2575*)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect probably null
Transcript: ENSMUST00000025497
AA Change: C2575*
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: C2575*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Adam1b A G 5: 121,501,918 C355R probably damaging Het
Adamtsl3 T C 7: 82,573,909 L966P probably damaging Het
Aldh18a1 A G 19: 40,564,847 C486R probably damaging Het
Aqp11 C A 7: 97,738,077 probably benign Het
Arhgap28 A G 17: 67,871,966 L350P probably damaging Het
Art3 A G 5: 92,403,655 Q291R probably benign Het
Asb15 A G 6: 24,559,030 probably null Het
Bmp8b T C 4: 123,105,655 I102T possibly damaging Het
Bsn T C 9: 108,114,815 D1246G probably benign Het
Cass4 G A 2: 172,426,798 G267S probably benign Het
Cass4 G T 2: 172,426,799 G267V probably benign Het
Ccr7 T C 11: 99,145,901 Y65C probably damaging Het
Clstn2 A C 9: 97,582,544 I186S probably benign Het
Cyp2r1 A G 7: 114,554,644 I105T possibly damaging Het
Efr3a T A 15: 65,815,413 probably null Het
Erg A C 16: 95,369,320 probably null Het
Eya4 A T 10: 23,111,658 V524E probably damaging Het
Farp1 C A 14: 121,235,177 N241K possibly damaging Het
Fat1 A T 8: 44,988,994 Y1111F probably benign Het
Fbn1 T C 2: 125,344,027 E1607G probably damaging Het
Fsip2 A T 2: 82,993,993 D6690V probably damaging Het
Fzd4 T C 7: 89,407,138 V131A possibly damaging Het
Gfral T A 9: 76,198,975 N110I probably benign Het
Glce T C 9: 62,060,993 D292G probably damaging Het
Gm19410 T A 8: 35,799,346 I1051K probably benign Het
Gm5773 A T 3: 93,773,016 probably benign Het
Hcn3 A T 3: 89,150,000 H430Q probably null Het
Hspa8 T A 9: 40,802,959 probably null Het
Ifna7 A T 4: 88,816,427 D67V possibly damaging Het
Kif5c T A 2: 49,701,093 M319K probably benign Het
Klk7 G T 7: 43,812,773 probably null Het
Kmt2c T C 5: 25,414,970 K102E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrp1b C T 2: 40,875,122 M2897I Het
Lysmd2 T C 9: 75,637,237 S211P probably damaging Het
Magi1 T G 6: 93,708,114 E761A probably benign Het
Mbd5 T A 2: 49,251,343 I106N probably damaging Het
Mdc1 G A 17: 35,848,857 A669T probably null Het
Mmp1b A G 9: 7,384,753 I265T probably benign Het
Mmp2 T A 8: 92,836,966 L356Q probably null Het
Mroh8 A G 2: 157,269,572 L154P probably benign Het
Muc13 T C 16: 33,799,436 S185P unknown Het
Nuak1 T A 10: 84,374,539 I562F probably benign Het
Obscn C A 11: 59,042,838 probably null Het
Olfr1137 A T 2: 87,711,771 M45K probably damaging Het
Olfr574 T C 7: 102,948,591 I42T possibly damaging Het
Olfr827 T C 10: 130,210,984 M49V probably benign Het
Pex3 T C 10: 13,542,670 M81V probably benign Het
Pex5l T A 3: 33,082,035 I12F probably benign Het
Phf3 G T 1: 30,831,475 T164N probably benign Het
Phpt1 G T 2: 25,574,832 A3E probably benign Het
Pja2 A T 17: 64,309,415 L162M probably damaging Het
Pkdrej T A 15: 85,819,793 K647N probably damaging Het
Ppp2r1a T C 17: 20,962,682 S543P possibly damaging Het
Prdm13 C A 4: 21,679,072 D473Y probably damaging Het
Prl6a1 A T 13: 27,318,971 E183D probably damaging Het
Psmd3 C T 11: 98,690,961 T304M probably benign Het
Ptpn5 C T 7: 47,086,126 probably null Het
Rassf6 T G 5: 90,606,802 I206L probably damaging Het
Rif1 A G 2: 52,078,507 H234R possibly damaging Het
Rint1 T C 5: 23,815,704 V575A probably benign Het
Ros1 G A 10: 52,145,834 T639I probably damaging Het
Ryr2 A G 13: 11,737,985 F1817L probably benign Het
Ska1 T C 18: 74,200,017 D110G probably benign Het
Slc25a41 G A 17: 57,033,791 T227I probably damaging Het
Slc6a15 T C 10: 103,389,137 S29P probably benign Het
Slc8a3 A T 12: 81,314,770 I425K probably benign Het
Sox8 T A 17: 25,567,961 Q256L probably damaging Het
Tarsl2 T C 7: 65,647,593 V152A probably damaging Het
Tbx10 A T 19: 3,996,651 T44S probably benign Het
Terb1 T A 8: 104,498,084 I52F possibly damaging Het
Tes AGCCGGCC AGCC 6: 17,099,741 probably null Het
Tgm1 A G 14: 55,705,903 V527A probably benign Het
Tmed10 G T 12: 85,344,262 Y167* probably null Het
Tmem165 T G 5: 76,208,568 S318R possibly damaging Het
Trim9 G T 12: 70,346,941 S76R probably damaging Het
Tti1 A G 2: 158,007,168 V717A probably damaging Het
Vmn2r86 T A 10: 130,446,828 I640F probably damaging Het
Vwf A G 6: 125,626,267 N860S Het
Xirp2 A G 2: 67,508,897 K494R possibly damaging Het
Zkscan4 G A 13: 21,484,249 S319N probably damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
pinch UTSW 18 58069184 missense probably damaging 1.00
stick UTSW 18 58071819 missense possibly damaging 0.94
tweak UTSW 18 58058389 missense probably damaging 1.00
PIT4434001:Fbn2 UTSW 18 58096062 missense probably damaging 0.99
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1623:Fbn2 UTSW 18 58048548 missense possibly damaging 0.61
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
R7056:Fbn2 UTSW 18 58076726 missense probably benign
R7199:Fbn2 UTSW 18 58053761 nonsense probably null
R7219:Fbn2 UTSW 18 58053027 missense probably benign 0.04
R7226:Fbn2 UTSW 18 58037070 missense probably damaging 1.00
R7260:Fbn2 UTSW 18 58066116 missense probably benign 0.14
R7414:Fbn2 UTSW 18 58096050 missense probably damaging 1.00
R7485:Fbn2 UTSW 18 58071840 missense possibly damaging 0.50
R7523:Fbn2 UTSW 18 58066080 missense probably benign 0.01
R7619:Fbn2 UTSW 18 58080227 missense possibly damaging 0.46
R7638:Fbn2 UTSW 18 58105136 missense probably damaging 1.00
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATTGTGTGGGAGGCACCATG -3'
(R):5'- GACTTAAAATGCTTGCCCCAC -3'

Sequencing Primer
(F):5'- GACAGGGTCTTTTGCTAAACCCAG -3'
(R):5'- ATGCTTGCCCCACCAAGTG -3'
Posted On2019-10-17