Mutagenetix > Incidental Mutation

Incidental Mutation 'R0617:Syne1'

58446

Institutional Source

Beutler Lab

Gene Symbol

Syne1

Ensembl Gene

ENSMUSG00000096054

Gene Name

spectrin repeat containing, nuclear envelope 1

Synonyms

A330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik

MMRRC Submission

038806-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0617 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5020917-5551482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5350933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 932 (V932M)

Ref Sequence

ENSEMBL: ENSMUSP00000150262 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000215295]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041639
AA Change: V932M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: V932M

Domain	Start	End	E-Value	Type
CH	29	139	4.55e-14	SMART
low complexity region	145	167	N/A	INTRINSIC
CH	187	285	9.67e-18	SMART
coiled coil region	425	452	N/A	INTRINSIC
Blast:SPEC	493	599	2e-28	BLAST
Blast:SPEC	606	695	7e-40	BLAST
Blast:SPEC	701	815	1e-32	BLAST
Blast:SPEC	815	913	4e-41	BLAST
Blast:SPEC	920	1013	9e-53	BLAST
Blast:SPEC	1117	1219	2e-60	BLAST
coiled coil region	1267	1329	N/A	INTRINSIC
low complexity region	1349	1368	N/A	INTRINSIC
coiled coil region	1399	1427	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215295
AA Change: V932M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215887

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

98% (130/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 130 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	C	A	19: 11,112,400	L40F	probably damaging	Het
4930555F03Rik	A	T	8: 49,500,492		noncoding transcript	Het
A630073D07Rik	T	C	6: 132,626,737		probably benign	Het
Abca16	G	A	7: 120,433,611		probably benign	Het
Abca5	A	T	11: 110,279,689	D1265E	probably damaging	Het
Abcf1	C	T	17: 35,961,187	V312I	probably benign	Het
Abhd12	T	A	2: 150,846,365		probably null	Het
Adam23	A	G	1: 63,543,147	H318R	probably benign	Het
Adcy2	T	A	13: 68,678,606	K660*	probably null	Het
Adgrf3	T	C	5: 30,195,080	T972A	probably benign	Het
Adipoq	T	A	16: 23,155,410	D62E	probably damaging	Het
Akap2	T	C	4: 57,829,434		probably benign	Het
Alk	G	T	17: 72,603,583	P43T	probably damaging	Het
Arap2	AT	ATT	5: 62,649,907		probably benign	Het
Arhgef28	G	T	13: 97,970,355	T687K	probably benign	Het
Arrb1	T	C	7: 99,594,677	L278P	probably damaging	Het
Atad2b	C	A	12: 4,937,401	D76E	probably benign	Het
Atm	A	T	9: 53,458,941	Y2290*	probably null	Het
Atrn	T	A	2: 130,995,085		probably null	Het
Bpifb1	A	G	2: 154,212,947	D253G	possibly damaging	Het
Bpifb9b	C	T	2: 154,319,625	T559M	probably benign	Het
Bsn	T	C	9: 108,107,240	E3205G	unknown	Het
Cacna1c	T	C	6: 118,602,213	Y1599C	probably damaging	Het
Ccdc40	A	G	11: 119,242,804	D590G	probably damaging	Het
Ccdc68	A	G	18: 69,946,552		probably null	Het
Ccdc97	G	A	7: 25,714,420	R279C	probably damaging	Het
Ccm2l	A	G	2: 153,070,900	T120A	probably damaging	Het
Cfap54	T	C	10: 92,829,650		probably benign	Het
Cfh	A	G	1: 140,100,883	S1043P	probably benign	Het
Chil3	T	C	3: 106,155,756	K173E	probably benign	Het
Cib2	T	C	9: 54,554,496	D26G	possibly damaging	Het
Col24a1	T	C	3: 145,314,120	V84A	probably damaging	Het
Csn3	T	C	5: 87,929,871	Y79H	probably benign	Het
Ddx47	T	A	6: 135,017,122	V149E	probably damaging	Het
Dennd5b	A	T	6: 149,033,262		probably benign	Het
Desi1	T	C	15: 81,998,198	N109D	probably damaging	Het
Fam13c	T	C	10: 70,536,352		probably benign	Het
Fam234a	A	T	17: 26,216,617	D264E	probably benign	Het
Fanca	A	G	8: 123,288,070	F831S	probably damaging	Het
Fancm	C	T	12: 65,097,317	R518*	probably null	Het
Fat2	A	G	11: 55,311,843	V135A	possibly damaging	Het
Fbxl17	A	C	17: 63,384,992	F42V	probably damaging	Het
Fgd3	A	T	13: 49,264,697	V631E	possibly damaging	Het
Fhod3	G	A	18: 25,112,679		probably benign	Het
Focad	T	C	4: 88,121,288		probably benign	Het
Foxn4	C	A	5: 114,261,068		probably benign	Het
Gm1673	T	C	5: 33,983,552		probably benign	Het
Gm2381	A	T	7: 42,819,978	C241S	probably damaging	Het
Gm6483	T	G	8: 19,693,709	F117V	probably damaging	Het
Hectd4	T	C	5: 121,343,232		probably benign	Het
Hecw1	T	A	13: 14,280,442	Q676L	probably benign	Het
Hipk2	G	A	6: 38,747,485	R437C	possibly damaging	Het
Ifnar1	T	C	16: 91,501,682	Y396H	probably damaging	Het
Ints5	A	T	19: 8,896,019	K447N	probably damaging	Het
Iqsec1	T	C	6: 90,689,970	Y495C	probably damaging	Het
Itga5	C	T	15: 103,356,315		probably null	Het
Kcnk4	T	A	19: 6,928,160		probably benign	Het
Kmo	A	G	1: 175,647,190	T174A	possibly damaging	Het
Krt36	T	C	11: 100,102,275	D458G	probably damaging	Het
Krtap16-1	G	T	11: 99,986,495	P28T	probably damaging	Het
Lama3	T	C	18: 12,419,258		probably null	Het
Lrrc9	T	C	12: 72,483,014	S920P	probably damaging	Het
Lrrk2	A	T	15: 91,752,278	Y1485F	probably benign	Het
Mical1	C	T	10: 41,481,315	A372V	probably damaging	Het
Mtr	C	T	13: 12,221,432	R636Q	probably benign	Het
Muc4	A	T	16: 32,752,107	T662S	possibly damaging	Het
Myo10	G	A	15: 25,738,005	V546M	probably damaging	Het
Nbeal1	G	A	1: 60,281,832	W2034*	probably null	Het
Nhlrc3	T	C	3: 53,458,623	T150A	probably damaging	Het
Nkx2-1	T	C	12: 56,534,855	H69R	possibly damaging	Het
Nlrp4g	A	T	9: 124,349,540		noncoding transcript	Het
Nod2	A	G	8: 88,653,231	N120S	probably benign	Het
Nol8	T	C	13: 49,654,445	F46L	possibly damaging	Het
Ntrk1	T	C	3: 87,783,933	D308G	possibly damaging	Het
Olfr1036	A	G	2: 86,075,141	M134V	probably benign	Het
Olfr1124	A	G	2: 87,434,661	D58G	probably damaging	Het
Olfr1196	A	G	2: 88,700,696	V211A	probably damaging	Het
Olfr1459	T	C	19: 13,146,363	M99V	probably benign	Het
Olfr1477	C	A	19: 13,502,536	N64K	probably damaging	Het
Olfr313	T	C	11: 58,817,149	V47A	probably damaging	Het
Olfr466	A	T	13: 65,152,878	Y218F	possibly damaging	Het
Olfr640	A	T	7: 104,021,989	S110T	probably damaging	Het
Oog3	A	T	4: 144,160,214	V112D	probably benign	Het
Pcdhb8	C	T	18: 37,357,047	R593C	probably benign	Het
Pgm3	A	G	9: 86,556,190		probably null	Het
Pirt	T	A	11: 66,926,172	V103E	probably damaging	Het
Plxnc1	T	A	10: 94,799,368	D1332V	probably damaging	Het
Ppfia4	A	T	1: 134,328,780	V122E	probably damaging	Het
Pramef17	A	G	4: 143,993,518		probably benign	Het
Prmt2	C	T	10: 76,208,683		probably benign	Het
Prrc2a	G	T	17: 35,153,560	P1702T	probably damaging	Het
Prss39	A	T	1: 34,500,198	H173L	probably damaging	Het
Rabl6	A	G	2: 25,586,866		probably null	Het
Rb1cc1	T	A	1: 6,248,790	I794K	possibly damaging	Het
Reln	T	C	5: 21,920,537	D2716G	probably damaging	Het
Sbf2	ACC	AC	7: 110,330,683		probably null	Het
Sema6d	T	A	2: 124,660,745	F583L	possibly damaging	Het
Setx	T	A	2: 29,146,807	H1101Q	possibly damaging	Het
Sis	A	G	3: 72,965,605	C67R	probably damaging	Het
Skint1	T	A	4: 112,029,399		probably benign	Het
Smg6	C	A	11: 75,162,931	T1413K	probably benign	Het
Spata31d1a	A	T	13: 59,702,259	I685N	possibly damaging	Het
Spef2	T	A	15: 9,592,758	N1499I	probably damaging	Het
Stk11ip	T	A	1: 75,532,288		probably null	Het
Stxbp1	A	C	2: 32,802,783	I407S	probably damaging	Het
Svil	T	C	18: 5,117,002	S2059P	probably damaging	Het
Tacc1	A	C	8: 25,178,004		probably benign	Het
Tbc1d13	C	A	2: 30,135,564		probably benign	Het
Tbc1d15	A	C	10: 115,239,299	D59E	probably damaging	Het
Tcaf2	A	G	6: 42,642,511	F194S	probably damaging	Het
Terf2ip	T	A	8: 112,011,495	M5K	probably benign	Het
Tgfbr2	A	T	9: 116,158,320	D40E	probably benign	Het
Tm4sf5	T	A	11: 70,510,669	S165T	probably damaging	Het
Tmprss3	A	T	17: 31,193,912	C129S	probably damaging	Het
Tmx2	T	C	2: 84,672,396	D256G	probably benign	Het
Tnr	A	G	1: 159,868,103	D532G	probably damaging	Het
Tnrc18	T	A	5: 142,776,739	H465L	unknown	Het
Togaram2	A	T	17: 71,700,509	Q350L	possibly damaging	Het
Topaz1	G	A	9: 122,749,906	C627Y	possibly damaging	Het
Tpx2	A	T	2: 152,873,138	Q93L	probably benign	Het
Trim54	T	C	5: 31,136,182		probably null	Het
Troap	T	A	15: 99,082,660	C574S	probably damaging	Het
Ubr4	T	C	4: 139,479,062		probably null	Het
Vmn2r51	A	G	7: 10,100,469	V214A	possibly damaging	Het
Vmn2r66	A	T	7: 84,995,276	M642K	probably benign	Het
Vwa5a	T	A	9: 38,723,895	I232N	probably damaging	Het
Zcchc6	A	T	13: 59,816,855		probably null	Het
Zfp820	A	T	17: 21,819,704	S214R	probably damaging	Het
Zfp955b	A	T	17: 33,305,463	S43R	probably damaging	Het
Zgrf1	C	T	3: 127,588,038	T1162M	probably benign	Het

Other mutations in Syne1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Syne1	APN	10	5342167	synonymous	probably benign
IGL00725:Syne1	APN	10	5344922	missense	possibly damaging	0.48
IGL00799:Syne1	APN	10	5347878	missense	probably benign	0.00
IGL01087:Syne1	APN	10	5425708	missense	probably damaging	1.00
IGL01123:Syne1	APN	10	5344921	nonsense	probably null
IGL01147:Syne1	APN	10	5052691	nonsense	probably null
IGL01150:Syne1	APN	10	5443154	missense	probably damaging	1.00
IGL01154:Syne1	APN	10	5360848	missense	probably damaging	1.00
IGL01727:Syne1	APN	10	5047842	missense	probably damaging	0.99
IGL01761:Syne1	APN	10	5405456	missense	probably damaging	1.00
IGL01793:Syne1	APN	10	5352191	missense	possibly damaging	0.67
IGL01961:Syne1	APN	10	5043723	missense	possibly damaging	0.94
IGL01975:Syne1	APN	10	5068908	intron	probably benign
IGL02152:Syne1	APN	10	5424382	missense	probably damaging	1.00
IGL02423:Syne1	APN	10	5368295	missense	probably benign	0.00
IGL02457:Syne1	APN	10	5342167	missense	probably damaging	1.00
IGL02543:Syne1	APN	10	5043618	missense	probably damaging	0.97
IGL02836:Syne1	APN	10	5409875	splice site	probably benign
IGL03141:Syne1	APN	10	5424261	missense	probably damaging	1.00
FR4548:Syne1	UTSW	10	5032969	missense	probably benign	0.09
IGL02799:Syne1	UTSW	10	5359059	missense	probably damaging	1.00
PIT4305001:Syne1	UTSW	10	5333023	missense	probably damaging	1.00
PIT4687001:Syne1	UTSW	10	5358390	missense	possibly damaging	0.87
R0004:Syne1	UTSW	10	5443132	splice site	probably benign
R0110:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0165:Syne1	UTSW	10	5033096	missense	probably benign	0.28
R0194:Syne1	UTSW	10	5424311	missense	probably benign
R0311:Syne1	UTSW	10	5348943	missense	possibly damaging	0.92
R0328:Syne1	UTSW	10	5348945	missense	possibly damaging	0.62
R0379:Syne1	UTSW	10	5541989	missense	probably damaging	1.00
R0387:Syne1	UTSW	10	5351029	missense	probably benign
R0452:Syne1	UTSW	10	5405435	missense	probably damaging	0.98
R0456:Syne1	UTSW	10	5342252	missense	probably benign	0.04
R0457:Syne1	UTSW	10	5022041	missense	probably damaging	1.00
R0469:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0510:Syne1	UTSW	10	5367600	missense	probably damaging	1.00
R0533:Syne1	UTSW	10	5358438	missense	probably benign	0.00
R0690:Syne1	UTSW	10	5033138	splice site	probably benign
R0964:Syne1	UTSW	10	5043652	missense	possibly damaging	0.95
R1133:Syne1	UTSW	10	5349044	missense	possibly damaging	0.77
R1327:Syne1	UTSW	10	5048925	splice site	probably benign
R1339:Syne1	UTSW	10	5367571	missense	probably damaging	1.00
R1531:Syne1	UTSW	10	5347875	nonsense	probably null
R1558:Syne1	UTSW	10	5349280	nonsense	probably null
R1633:Syne1	UTSW	10	5349388	missense	probably damaging	1.00
R1642:Syne1	UTSW	10	5348694	missense	possibly damaging	0.94
R1658:Syne1	UTSW	10	5367616	missense	probably benign	0.03
R1753:Syne1	UTSW	10	5367621	missense	probably benign	0.28
R1759:Syne1	UTSW	10	5349369	missense	probably damaging	1.00
R1792:Syne1	UTSW	10	5040975	missense	probably damaging	1.00
R2076:Syne1	UTSW	10	5040897	missense	probably damaging	0.99
R2079:Syne1	UTSW	10	5361502	missense	probably benign	0.01
R2102:Syne1	UTSW	10	5056514	missense	probably damaging	1.00
R2233:Syne1	UTSW	10	5041484	missense	probably benign	0.01
R2305:Syne1	UTSW	10	5047573	missense	probably damaging	0.97
R3435:Syne1	UTSW	10	5348565	missense	probably damaging	1.00
R3749:Syne1	UTSW	10	5052267	splice site	probably benign
R3876:Syne1	UTSW	10	5052345	missense	possibly damaging	0.57
R3895:Syne1	UTSW	10	5405456	missense	probably damaging	0.98
R3974:Syne1	UTSW	10	5043630	missense	probably benign	0.06
R4042:Syne1	UTSW	10	5041584	missense	probably benign	0.21
R4120:Syne1	UTSW	10	5409798	missense	probably damaging	1.00
R4201:Syne1	UTSW	10	5347870	missense	probably benign
R4364:Syne1	UTSW	10	5353987	missense	probably damaging	0.96
R4498:Syne1	UTSW	10	5031768	missense	probably benign	0.00
R4767:Syne1	UTSW	10	5344866	nonsense	probably null
R4804:Syne1	UTSW	10	5349310	missense	possibly damaging	0.95
R4917:Syne1	UTSW	10	5057909	missense	probably damaging	1.00
R4930:Syne1	UTSW	10	5052777	missense	probably damaging	0.99
R5081:Syne1	UTSW	10	5047767	missense	probably benign	0.04
R5089:Syne1	UTSW	10	5405444	nonsense	probably null
R5174:Syne1	UTSW	10	5041490	missense	probably damaging	0.99
R5205:Syne1	UTSW	10	5052295	missense	probably benign	0.05
R5303:Syne1	UTSW	10	5420464	missense	probably benign	0.00
R5384:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5385:Syne1	UTSW	10	5041494	missense	probably benign	0.00
R5392:Syne1	UTSW	10	5348661	missense	probably damaging	1.00
R5442:Syne1	UTSW	10	5343473	missense	probably benign	0.09
R5750:Syne1	UTSW	10	5339209	missense	probably benign	0.01
R5935:Syne1	UTSW	10	5360706	splice site	probably null
R6015:Syne1	UTSW	10	5346819	critical splice donor site	probably null
R6023:Syne1	UTSW	10	5443223	missense	probably benign	0.09
R6049:Syne1	UTSW	10	5347926	missense	possibly damaging	0.79
R6084:Syne1	UTSW	10	5348994	missense	probably damaging	1.00
R6145:Syne1	UTSW	10	5052750	missense	probably damaging	1.00
R6164:Syne1	UTSW	10	5061429	missense	probably damaging	1.00
R6165:Syne1	UTSW	10	5425678	missense	probably damaging	1.00
R6198:Syne1	UTSW	10	5302269	missense	probably damaging	0.99
R6217:Syne1	UTSW	10	5293761	missense	probably benign	0.00
R6247:Syne1	UTSW	10	5349071	missense	probably damaging	0.98
R6271:Syne1	UTSW	10	5234652	missense	probably damaging	1.00
R6338:Syne1	UTSW	10	5255475	missense	probably benign	0.00
R6344:Syne1	UTSW	10	5022212	missense	probably benign	0.08
R6434:Syne1	UTSW	10	5318422	missense	probably benign	0.01
R6476:Syne1	UTSW	10	5154531	missense	possibly damaging	0.88
R6479:Syne1	UTSW	10	5231679	nonsense	probably null
R6479:Syne1	UTSW	10	5456826	missense	probably damaging	1.00
R6546:Syne1	UTSW	10	5218645	nonsense	probably null
R6578:Syne1	UTSW	10	5405454	nonsense	probably null
R6611:Syne1	UTSW	10	5045273	missense	probably benign	0.01
R6615:Syne1	UTSW	10	5301340	missense	probably damaging	0.98
R6632:Syne1	UTSW	10	5215667	critical splice donor site	probably null
R6662:Syne1	UTSW	10	5128416	missense	probably damaging	1.00
R6677:Syne1	UTSW	10	5040942	missense	possibly damaging	0.82
R6764:Syne1	UTSW	10	5229011	nonsense	probably null
R6765:Syne1	UTSW	10	5143285	splice site	probably null
R6778:Syne1	UTSW	10	5102406	missense	probably damaging	0.97
R6851:Syne1	UTSW	10	5262703	nonsense	probably null
R6878:Syne1	UTSW	10	5420388	missense	possibly damaging	0.78
R6883:Syne1	UTSW	10	5231704	nonsense	probably null
R6910:Syne1	UTSW	10	5048887	missense	probably benign	0.01
R6916:Syne1	UTSW	10	5227912	missense	probably benign	0.00
R6925:Syne1	UTSW	10	5126682	missense	probably benign	0.00
R6943:Syne1	UTSW	10	5083940	missense	probably benign
R6947:Syne1	UTSW	10	5175789	missense	probably damaging	1.00
R6965:Syne1	UTSW	10	5229120	missense	possibly damaging	0.66
R6968:Syne1	UTSW	10	5117041	missense	probably benign	0.09
R7043:Syne1	UTSW	10	5072193	missense	possibly damaging	0.77
R7059:Syne1	UTSW	10	5346859	missense	probably damaging	1.00
R7067:Syne1	UTSW	10	5234586	missense	probably damaging	1.00
R7087:Syne1	UTSW	10	5542024	start gained	probably benign
R7099:Syne1	UTSW	10	5123744	missense	probably benign	0.43
R7107:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7120:Syne1	UTSW	10	5293971	missense	probably benign
R7127:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7128:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7131:Syne1	UTSW	10	5228221	missense	probably damaging	1.00
R7132:Syne1	UTSW	10	5243180	missense	probably damaging	1.00
R7133:Syne1	UTSW	10	5231592	missense	probably damaging	1.00
R7135:Syne1	UTSW	10	5233409	missense	probably benign	0.01
R7147:Syne1	UTSW	10	5249340	missense	probably damaging	1.00
R7158:Syne1	UTSW	10	5057931	missense	probably damaging	1.00
R7189:Syne1	UTSW	10	5424295	missense	probably benign	0.03
R7193:Syne1	UTSW	10	5233406	missense	probably damaging	1.00
R7194:Syne1	UTSW	10	5110859	missense	probably damaging	1.00
R7233:Syne1	UTSW	10	5302160	missense	probably damaging	1.00
R7255:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7267:Syne1	UTSW	10	5228218	missense	probably damaging	1.00
R7294:Syne1	UTSW	10	5097483	critical splice donor site	probably null
R7303:Syne1	UTSW	10	5256805	missense	probably benign	0.04
R7313:Syne1	UTSW	10	5047635	missense	probably damaging	1.00
R7330:Syne1	UTSW	10	5128434	missense	probably benign	0.00
R7334:Syne1	UTSW	10	5057886	missense	probably damaging	1.00
R7363:Syne1	UTSW	10	5140970	missense	possibly damaging	0.45
R7400:Syne1	UTSW	10	5218580	missense	probably benign	0.12
R7425:Syne1	UTSW	10	5425760	missense	probably damaging	1.00
R7427:Syne1	UTSW	10	5273718	missense	probably damaging	0.98
R7446:Syne1	UTSW	10	5222266	missense	probably benign	0.00
R7462:Syne1	UTSW	10	5052793	missense	possibly damaging	0.87
R7502:Syne1	UTSW	10	5333446	missense	probably damaging	0.98
R7525:Syne1	UTSW	10	5185559	critical splice acceptor site	probably null
R7529:Syne1	UTSW	10	5424382	missense	probably damaging	1.00
R7577:Syne1	UTSW	10	5124820	missense	probably damaging	1.00
R7579:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R7594:Syne1	UTSW	10	5215190	critical splice donor site	probably null
R7646:Syne1	UTSW	10	5172949	missense	probably damaging	1.00
R7651:Syne1	UTSW	10	5205074	missense	probably benign	0.38
R7651:Syne1	UTSW	10	5343416	missense	probably damaging	1.00
R7669:Syne1	UTSW	10	5061531	missense	probably damaging	1.00
R7672:Syne1	UTSW	10	5218527	missense	probably benign	0.02
R7682:Syne1	UTSW	10	5162461	missense	probably benign
R7702:Syne1	UTSW	10	5245835	missense	probably damaging	1.00
R7767:Syne1	UTSW	10	5333560	missense	possibly damaging	0.60
R7767:Syne1	UTSW	10	5333632	missense	possibly damaging	0.49
R7829:Syne1	UTSW	10	5342293	missense	probably damaging	0.96
R7840:Syne1	UTSW	10	5132078	missense	probably damaging	1.00
R7859:Syne1	UTSW	10	5157683	missense	possibly damaging	0.80
R7899:Syne1	UTSW	10	5227956	nonsense	probably null
R7918:Syne1	UTSW	10	5359078	missense	possibly damaging	0.50
R7923:Syne1	UTSW	10	5264738	missense	probably damaging	1.00
R7946:Syne1	UTSW	10	5250919	missense	possibly damaging	0.92
R7966:Syne1	UTSW	10	5116965	critical splice donor site	probably null
R7975:Syne1	UTSW	10	5031786	missense	probably benign	0.00
R7981:Syne1	UTSW	10	5229248	missense	probably benign	0.04
R8053:Syne1	UTSW	10	5052658	nonsense	probably null
R8054:Syne1	UTSW	10	5270970	missense	probably benign	0.22
R8062:Syne1	UTSW	10	5185394	critical splice donor site	probably null
R8085:Syne1	UTSW	10	5228021	missense	possibly damaging	0.78
R8087:Syne1	UTSW	10	5333034	missense	probably benign
R8094:Syne1	UTSW	10	5117031	missense	probably damaging	0.98
R8310:Syne1	UTSW	10	5347829	missense	probably benign
R8325:Syne1	UTSW	10	5146257	missense	probably benign	0.15
R8342:Syne1	UTSW	10	5108622	missense	probably benign	0.18
R8353:Syne1	UTSW	10	5350983	missense	probably damaging	1.00
R8376:Syne1	UTSW	10	5043615	missense	probably benign	0.09
R8398:Syne1	UTSW	10	5124923	missense	probably damaging	1.00
R8434:Syne1	UTSW	10	5123057	missense	probably benign	0.00
R8436:Syne1	UTSW	10	5228659	missense	probably benign	0.26
R8459:Syne1	UTSW	10	5424277	nonsense	probably null
R8461:Syne1	UTSW	10	5061463	missense	probably benign	0.34
R8496:Syne1	UTSW	10	5228896	missense	probably damaging	0.99
R8496:Syne1	UTSW	10	5318441	missense	probably damaging	0.99
R8693:Syne1	UTSW	10	5140928	missense	possibly damaging	0.60
R8698:Syne1	UTSW	10	5229229	missense	probably damaging	1.00
R8701:Syne1	UTSW	10	5205026	nonsense	probably null
R8713:Syne1	UTSW	10	5316040	missense	probably damaging	1.00
R8724:Syne1	UTSW	10	5083861	missense	possibly damaging	0.77
R8729:Syne1	UTSW	10	5229275	missense	probably benign	0.00
R8742:Syne1	UTSW	10	5108661	missense	probably benign	0.09
R8757:Syne1	UTSW	10	5194618	missense	probably damaging	1.00
R8776:Syne1	UTSW	10	5231783	missense	possibly damaging	0.81
R8776-TAIL:Syne1	UTSW	10	5231783	missense	possibly damaging	0.81
R8778:Syne1	UTSW	10	5359066	missense	probably benign	0.00
R8801:Syne1	UTSW	10	5358335	missense	probably damaging	1.00
R8803:Syne1	UTSW	10	5361535	missense	probably damaging	1.00
R8808:Syne1	UTSW	10	5359074	missense	probably damaging	1.00
R8829:Syne1	UTSW	10	5108685	missense	probably benign
R8843:Syne1	UTSW	10	5193040	missense	possibly damaging	0.88
R8843:Syne1	UTSW	10	5330204	missense	probably benign	0.01
R8854:Syne1	UTSW	10	5128503	missense	probably benign	0.00
R8863:Syne1	UTSW	10	5099527	missense	probably damaging	1.00
R8864:Syne1	UTSW	10	5420473	missense	probably benign	0.01
R8881:Syne1	UTSW	10	5273639	missense	probably damaging	1.00
R8884:Syne1	UTSW	10	5231822	missense	possibly damaging	0.93
R8893:Syne1	UTSW	10	5349020	nonsense	probably null
R8958:Syne1	UTSW	10	5231768	missense	probably benign
R8964:Syne1	UTSW	10	5110872	missense
R8975:Syne1	UTSW	10	5211945	missense	probably benign	0.04
R8987:Syne1	UTSW	10	5227579	missense	possibly damaging	0.92
R8992:Syne1	UTSW	10	5185508	missense	probably benign	0.01
R9005:Syne1	UTSW	10	5205406	missense	probably benign
R9084:Syne1	UTSW	10	5339240	missense	probably benign	0.01
R9117:Syne1	UTSW	10	5103667	missense	probably damaging	0.96
R9128:Syne1	UTSW	10	5108556	missense	probably benign	0.38
R9181:Syne1	UTSW	10	5113994	missense	probably damaging	0.99
R9189:Syne1	UTSW	10	5173008	missense	probably damaging	1.00
R9189:Syne1	UTSW	10	5222289	missense	probably benign	0.00
R9205:Syne1	UTSW	10	5202013	nonsense	probably null
R9217:Syne1	UTSW	10	5349324	missense	probably damaging	1.00
R9246:Syne1	UTSW	10	5305706	missense	probably benign	0.00
R9264:Syne1	UTSW	10	5262793	missense	probably damaging	1.00
R9273:Syne1	UTSW	10	5040901	missense	probably benign	0.16
R9315:Syne1	UTSW	10	5333553	missense	possibly damaging	0.79
R9331:Syne1	UTSW	10	5123666	missense	probably benign	0.45
R9355:Syne1	UTSW	10	5368255	missense	probably damaging	1.00
R9378:Syne1	UTSW	10	5250954	missense	probably damaging	0.96
R9389:Syne1	UTSW	10	5229193	missense	possibly damaging	0.65
R9395:Syne1	UTSW	10	5311728	missense	probably damaging	1.00
R9405:Syne1	UTSW	10	5202030	missense	probably damaging	1.00
R9417:Syne1	UTSW	10	5132021	missense	probably benign
R9419:Syne1	UTSW	10	5205071	missense	probably benign	0.01
R9473:Syne1	UTSW	10	5248258	missense	probably benign	0.00
R9484:Syne1	UTSW	10	5220359	missense	probably damaging	1.00
R9505:Syne1	UTSW	10	5030394	missense	probably benign	0.00
R9509:Syne1	UTSW	10	5348927	critical splice donor site	probably null
R9546:Syne1	UTSW	10	5243123	missense	probably damaging	1.00
R9567:Syne1	UTSW	10	5246386	missense	possibly damaging	0.54
R9601:Syne1	UTSW	10	5259270	missense	probably benign	0.23
R9619:Syne1	UTSW	10	5140909	missense	probably benign	0.03
R9621:Syne1	UTSW	10	5323887	missense	probably benign	0.01
R9623:Syne1	UTSW	10	5202009	missense	probably damaging	1.00
R9646:Syne1	UTSW	10	5229187	missense	possibly damaging	0.95
R9666:Syne1	UTSW	10	5034937	missense	probably damaging	1.00
R9677:Syne1	UTSW	10	5265125	missense	probably damaging	1.00
R9695:Syne1	UTSW	10	5318461	missense	probably benign	0.03
R9696:Syne1	UTSW	10	5347847	missense	probably benign	0.00
R9719:Syne1	UTSW	10	5326601	missense	possibly damaging	0.47
R9744:Syne1	UTSW	10	5324184	missense	probably benign	0.01
R9761:Syne1	UTSW	10	5368190	critical splice donor site	probably null
R9763:Syne1	UTSW	10	5057858	missense	probably benign	0.31
RF010:Syne1	UTSW	10	5246386	missense	possibly damaging	0.89
RF015:Syne1	UTSW	10	5302248	missense	probably benign	0.01
RF023:Syne1	UTSW	10	5255482	missense	probably damaging	1.00
X0017:Syne1	UTSW	10	5346917	missense	probably damaging	1.00
X0025:Syne1	UTSW	10	5358973	nonsense	probably null
X0063:Syne1	UTSW	10	5052354	missense	probably damaging	1.00
Z1176:Syne1	UTSW	10	5248364	missense	probably damaging	0.96
Z1176:Syne1	UTSW	10	5259280	missense	probably benign
Z1176:Syne1	UTSW	10	5330251	missense	probably benign	0.10
Z1177:Syne1	UTSW	10	5143230	missense	possibly damaging	0.78
Z1177:Syne1	UTSW	10	5259349	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGGGTGGTCTCAAATAACCCAAC -3'
(R):5'- TGCTTCGAGCTTCTGGATTGAATTCC -3'

Sequencing Primer
(F):5'- CTAGGGTCTGATGCCCTTAAAG -3'
(R):5'- CTGGATTGAATTCCAGGATACCAAG -3'

Posted On

2013-07-11