Incidental Mutation 'R7552:D630045J12Rik'
ID584464
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7552 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38148448 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1544 (S1544P)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably damaging
Transcript: ENSMUST00000117556
AA Change: S1403P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: S1403P

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169256
AA Change: S1544P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: S1544P

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Nlrp9b T C 7: 20,045,766 S785P probably benign Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Olfr791 T A 10: 129,526,560 F111Y possibly damaging Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Snx29 T A 16: 11,420,785 probably null Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vmn2r88 A T 14: 51,410,858 probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp763 A G 17: 33,018,651 Y507H probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R6930:D630045J12Rik UTSW 6 38158216 missense probably damaging 1.00
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38174303 missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38142666 missense possibly damaging 0.89
R7560:D630045J12Rik UTSW 6 38196627 missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38195494 missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38149563 missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38177701 missense probably damaging 1.00
R7950:D630045J12Rik UTSW 6 38181310 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCATGCCCAGTGTCTTGC -3'
(R):5'- ATCAAGCCTGCAGAGCAAGG -3'

Sequencing Primer
(F):5'- CAGTGTCTTGCCTGCCTG -3'
(R):5'- GGGGACATCTCTAAAAGCACTGTAC -3'
Posted On2019-10-17