Incidental Mutation 'R7552:Nlrp9b'
ID 584470
Institutional Source Beutler Lab
Gene Symbol Nlrp9b
Ensembl Gene ENSMUSG00000060508
Gene Name NLR family, pyrin domain containing 9B
Synonyms Nalp-delta, Nalp9b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7552 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 19991465-20073306 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20045766 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 785 (S785P)
Ref Sequence ENSEMBL: ENSMUSP00000072895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073151] [ENSMUST00000117909]
AlphaFold Q66X22
Predicted Effect probably benign
Transcript: ENSMUST00000073151
AA Change: S785P

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072895
Gene: ENSMUSG00000060508
AA Change: S785P

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 311 4.3e-34 PFAM
low complexity region 580 595 N/A INTRINSIC
LRR 630 657 2.16e2 SMART
LRR 691 718 2.23e2 SMART
LRR 747 774 6.67e-2 SMART
LRR 776 803 3.65e0 SMART
LRR 804 831 5.59e-4 SMART
LRR 833 860 2.81e0 SMART
LRR 861 888 8.87e-7 SMART
LRR 890 917 9.24e1 SMART
Blast:LRR 918 945 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117909
AA Change: S345P

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113762
Gene: ENSMUSG00000060508
AA Change: S345P

DomainStartEndE-ValueType
PYRIN 5 87 2.08e-23 SMART
Pfam:NACHT 143 179 2.8e-6 PFAM
LRR 190 217 2.16e2 SMART
LRR 251 278 2.23e2 SMART
LRR 307 334 6.67e-2 SMART
LRR 336 363 3.65e0 SMART
LRR 364 391 5.59e-4 SMART
LRR 393 420 2.81e0 SMART
Pfam:Chromo_shadow 450 501 2.9e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
PHENOTYPE: The protein protects against rotavirus infection. Homozygous KO leads to increased susceptibility to infection and greater severity of pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
D630045J12Rik A G 6: 38,148,448 S1544P probably damaging Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Olfr791 T A 10: 129,526,560 F111Y possibly damaging Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Snx29 T A 16: 11,420,785 probably null Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vmn2r88 A T 14: 51,410,858 probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp763 A G 17: 33,018,651 Y507H probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in Nlrp9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Nlrp9b APN 7 20023278 missense probably benign 0.43
IGL00675:Nlrp9b APN 7 20023186 missense possibly damaging 0.63
IGL00755:Nlrp9b APN 7 20023522 missense probably damaging 1.00
IGL01131:Nlrp9b APN 7 20023537 missense probably damaging 1.00
IGL01134:Nlrp9b APN 7 20023187 missense probably benign 0.06
IGL01464:Nlrp9b APN 7 20062655 missense probably benign 0.00
IGL01514:Nlrp9b APN 7 20045934 critical splice donor site probably null
IGL01731:Nlrp9b APN 7 20023417 nonsense probably null
IGL02427:Nlrp9b APN 7 20042501 missense probably damaging 1.00
IGL03013:Nlrp9b APN 7 20048825 missense probably damaging 1.00
R0037:Nlrp9b UTSW 7 20023722 missense probably damaging 0.99
R0114:Nlrp9b UTSW 7 20024056 missense probably benign 0.00
R0276:Nlrp9b UTSW 7 20028498 missense probably benign 0.21
R0346:Nlrp9b UTSW 7 20024515 missense probably damaging 0.99
R0736:Nlrp9b UTSW 7 20049450 missense probably damaging 1.00
R1449:Nlrp9b UTSW 7 20023164 missense possibly damaging 0.91
R1540:Nlrp9b UTSW 7 20048847 nonsense probably null
R1648:Nlrp9b UTSW 7 20026544 missense possibly damaging 0.89
R1878:Nlrp9b UTSW 7 20028564 missense probably benign 0.01
R1903:Nlrp9b UTSW 7 20023257 missense probably benign 0.44
R2191:Nlrp9b UTSW 7 20023662 missense probably benign
R4572:Nlrp9b UTSW 7 20026681 critical splice donor site probably null
R4863:Nlrp9b UTSW 7 20049596 critical splice donor site probably null
R4939:Nlrp9b UTSW 7 20024496 missense probably damaging 0.99
R5211:Nlrp9b UTSW 7 20049456 missense probably damaging 1.00
R5329:Nlrp9b UTSW 7 20023991 missense probably damaging 1.00
R5580:Nlrp9b UTSW 7 20023164 missense probably damaging 0.98
R5696:Nlrp9b UTSW 7 20024492 missense probably benign 0.02
R6265:Nlrp9b UTSW 7 20062683 missense probably benign
R6456:Nlrp9b UTSW 7 20048778 missense probably damaging 1.00
R6672:Nlrp9b UTSW 7 20019338 missense probably damaging 1.00
R6750:Nlrp9b UTSW 7 20023234 nonsense probably null
R6896:Nlrp9b UTSW 7 20023245 missense probably damaging 0.96
R6968:Nlrp9b UTSW 7 20049508 missense probably damaging 1.00
R7108:Nlrp9b UTSW 7 20045930 missense probably damaging 1.00
R7287:Nlrp9b UTSW 7 20028456 missense probably damaging 0.97
R7297:Nlrp9b UTSW 7 20049513 missense possibly damaging 0.81
R7485:Nlrp9b UTSW 7 20023950 missense probably damaging 1.00
R7573:Nlrp9b UTSW 7 20019200 missense probably damaging 1.00
R7690:Nlrp9b UTSW 7 20024370 missense probably benign 0.00
R7839:Nlrp9b UTSW 7 20024473 missense possibly damaging 0.49
R7913:Nlrp9b UTSW 7 20045800 missense probably benign 0.07
R7968:Nlrp9b UTSW 7 20028568 missense probably benign 0.01
R8113:Nlrp9b UTSW 7 20019335 missense probably benign 0.02
R8273:Nlrp9b UTSW 7 20024061 missense possibly damaging 0.89
R8400:Nlrp9b UTSW 7 20024012 nonsense probably null
R9047:Nlrp9b UTSW 7 20023476 missense possibly damaging 0.80
R9224:Nlrp9b UTSW 7 20019292 missense probably benign 0.00
R9224:Nlrp9b UTSW 7 20023551 missense probably benign 0.44
R9291:Nlrp9b UTSW 7 20024586 missense possibly damaging 0.80
R9348:Nlrp9b UTSW 7 20023411 missense probably damaging 1.00
R9398:Nlrp9b UTSW 7 20049510 missense probably damaging 1.00
R9442:Nlrp9b UTSW 7 20045782 missense possibly damaging 0.84
R9495:Nlrp9b UTSW 7 20026537 missense possibly damaging 0.64
R9598:Nlrp9b UTSW 7 20019377 missense probably benign 0.17
R9757:Nlrp9b UTSW 7 20048692 missense probably damaging 1.00
X0064:Nlrp9b UTSW 7 20048758 missense probably damaging 1.00
Z1088:Nlrp9b UTSW 7 20023743 missense probably benign 0.01
Z1177:Nlrp9b UTSW 7 20026646 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGATGTTGCACAAAGCTC -3'
(R):5'- AGCCCTACCATAACTCCTTGAG -3'

Sequencing Primer
(F):5'- TCTGAAAGCCATCTAGTCCTGGG -3'
(R):5'- TACCATAACTCCTTGAGGGTGCAG -3'
Posted On 2019-10-17