Incidental Mutation 'R7552:Olfr791'
ID584490
Institutional Source Beutler Lab
Gene Symbol Olfr791
Ensembl Gene ENSMUSG00000047626
Gene Nameolfactory receptor 791
SynonymsGA_x6K02T2PULF-11205096-11206034, MOR114-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7552 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129521792-129528353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129526560 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 111 (F111Y)
Ref Sequence ENSEMBL: ENSMUSP00000150497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057477] [ENSMUST00000217228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057477
AA Change: F111Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052722
Gene: ENSMUSG00000047626
AA Change: F111Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 7.6e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.3e-6 PFAM
Pfam:7tm_1 39 288 4.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217228
AA Change: F111Y

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
D630045J12Rik A G 6: 38,148,448 S1544P probably damaging Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Nlrp9b T C 7: 20,045,766 S785P probably benign Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Snx29 T A 16: 11,420,785 probably null Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vmn2r88 A T 14: 51,410,858 probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp763 A G 17: 33,018,651 Y507H probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in Olfr791
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Olfr791 APN 10 129526995 missense probably damaging 0.97
IGL03034:Olfr791 APN 10 129526658 missense probably benign
IGL03281:Olfr791 APN 10 129526403 missense probably benign 0.31
R0555:Olfr791 UTSW 10 129526896 missense possibly damaging 0.90
R1474:Olfr791 UTSW 10 129526955 missense probably benign 0.03
R1638:Olfr791 UTSW 10 129526619 missense probably benign 0.00
R1917:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1918:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R1919:Olfr791 UTSW 10 129527049 missense probably damaging 0.99
R2303:Olfr791 UTSW 10 129527049 missense probably benign 0.10
R3113:Olfr791 UTSW 10 129527143 missense probably benign 0.08
R3929:Olfr791 UTSW 10 129526231 start codon destroyed probably null 1.00
R4704:Olfr791 UTSW 10 129526302 missense possibly damaging 0.90
R4831:Olfr791 UTSW 10 129526580 missense probably damaging 1.00
R5207:Olfr791 UTSW 10 129526904 missense probably benign 0.08
R5313:Olfr791 UTSW 10 129527081 missense probably damaging 1.00
R5644:Olfr791 UTSW 10 129527103 missense probably damaging 1.00
R5661:Olfr791 UTSW 10 129526749 missense probably benign 0.45
R5894:Olfr791 UTSW 10 129526488 missense probably damaging 0.98
R6988:Olfr791 UTSW 10 129526673 missense probably benign 0.02
R6996:Olfr791 UTSW 10 129526863 missense probably damaging 1.00
R7380:Olfr791 UTSW 10 129526661 missense probably benign
R7539:Olfr791 UTSW 10 129527105 nonsense probably null
R7635:Olfr791 UTSW 10 129526682 missense probably benign 0.00
R8084:Olfr791 UTSW 10 129526940 missense probably damaging 1.00
R8260:Olfr791 UTSW 10 129527088 missense possibly damaging 0.55
X0066:Olfr791 UTSW 10 129526745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTACGTTGGTGGATCCC -3'
(R):5'- TCACAGCTGAAATGATCAATGGC -3'

Sequencing Primer
(F):5'- GGTGGATCCCCATCTTAAAACAC -3'
(R):5'- TGATCAATGGCATTGGAGTCAC -3'
Posted On2019-10-17