Mutagenetix > Incidental Mutation

Incidental Mutation 'R7552:Sdk2'

584497

Institutional Source

Beutler Lab

Gene Symbol

Sdk2

Ensembl Gene

ENSMUSG00000041592

Gene Name

sidekick cell adhesion molecule 2

Synonyms

5330435L01Rik, 4632412F08Rik

MMRRC Submission

045621-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7552 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113776374-114067046 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 113873213 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 249 (I249N)

Ref Sequence

ENSEMBL: ENSMUSP00000038972 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041627] [ENSMUST00000141943]

AlphaFold

Q6V4S5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041627
AA Change: I249N

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: I249N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	884	3.45e-5	SMART
FN3	899	981	2.36e-12	SMART
FN3	997	1084	1.64e-6	SMART
FN3	1101	1188	8.83e-12	SMART
FN3	1204	1289	3.62e-8	SMART
FN3	1305	1388	1.74e-10	SMART
FN3	1404	1489	8.23e-12	SMART
FN3	1506	1612	3.62e-8	SMART
FN3	1628	1713	1.15e-10	SMART
FN3	1728	1815	2.17e-11	SMART
FN3	1829	1913	5.04e-7	SMART
transmembrane domain	1935	1957	N/A	INTRINSIC
low complexity region	2138	2153	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141943
AA Change: I249N

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000116872
Gene: ENSMUSG00000041592
AA Change: I249N

Domain	Start	End	E-Value	Type
IGc2	43	102	4.67e-4	SMART
IG	123	208	6.07e-3	SMART
IG	225	309	1.4e-7	SMART
IGc2	325	391	6.21e-9	SMART
IGc2	418	486	8.57e-12	SMART
IG	506	591	2.37e-5	SMART
FN3	594	678	1.91e-7	SMART
FN3	694	780	2.42e-9	SMART
FN3	796	889	1.96e1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (89/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17a	A	G	10: 80,583,903	Y290H	probably benign	Het
Aco2	T	C	15: 81,903,941	V257A	probably damaging	Het
Adam26a	C	A	8: 43,569,970	C161F	possibly damaging	Het
Adam9	G	A	8: 24,955,972	P820S	unknown	Het
Adcy4	G	A	14: 55,773,465	T665M	probably benign	Het
AF529169	T	A	9: 89,601,835	H503L	probably benign	Het
Ahnak	T	A	19: 9,006,824	M1824K	probably benign	Het
Alpi	T	C	1: 87,099,073	N428D	probably benign	Het
Ano5	C	T	7: 51,546,780	P153L	probably benign	Het
Atp1a1	A	T	3: 101,582,121	L725*	probably null	Het
Atp8b2	G	A	3: 89,946,764	T595I	probably damaging	Het
Ccdc66	T	C	14: 27,498,863	I35V	possibly damaging	Het
Cd163	A	G	6: 124,307,228	T120A	probably benign	Het
Cmah	A	T	13: 24,456,955	T396S	possibly damaging	Het
Cmya5	C	T	13: 93,069,312	V3350I	probably benign	Het
Commd9	A	C	2: 101,901,065	K198N	probably damaging	Het
Cxcr1	A	G	1: 74,192,614	V83A	probably benign	Het
D630045J12Rik	A	G	6: 38,148,448	S1544P	probably damaging	Het
Ddt	A	T	10: 75,773,214		probably null	Het
Depdc7	A	G	2: 104,727,240	S222P	possibly damaging	Het
Ehd2	A	G	7: 15,950,506	I456T	probably damaging	Het
Epas1	A	T	17: 86,829,043	M748L	probably benign	Het
Esr1	G	A	10: 4,856,903	R273H	probably damaging	Het
Fras1	G	A	5: 96,768,438	D3444N	probably damaging	Het
Gm7682	G	A	5: 94,448,535	C477Y	probably damaging	Het
Hand2	A	G	8: 57,322,237	R111G	probably damaging	Het
Hecw1	A	T	13: 14,316,250	V306E	probably damaging	Het
Ift140	T	C	17: 25,033,115	I312T	probably benign	Het
Ikbke	A	T	1: 131,272,150	L257*	probably null	Het
Kcnk5	G	A	14: 20,142,281	P271S	probably benign	Het
Lama1	T	C	17: 67,737,667	V187A		Het
Lemd2	A	T	17: 27,193,836		probably null	Het
Lig3	T	A	11: 82,788,891	D341E	probably benign	Het
Lpcat1	C	T	13: 73,494,895	S196L	probably damaging	Het
Lrp1b	A	T	2: 40,677,570	D4048E		Het
Lrrfip1	G	A	1: 91,105,283	E158K	probably damaging	Het
Mcm5	T	C	8: 75,121,592	S490P	probably damaging	Het
Mia3	A	C	1: 183,365,695	Y73*	probably null	Het
Msr1	A	T	8: 39,623,962	N202K	probably benign	Het
N4bp2l2	A	T	5: 150,661,821	Y231*	probably null	Het
Nbeal2	A	G	9: 110,653,917	W11R	probably benign	Het
Ncor1	T	C	11: 62,373,424	E384G	possibly damaging	Het
Neb	A	G	2: 52,247,190	V254A		Het
Nlrp9b	T	C	7: 20,045,766	S785P	probably benign	Het
Olfr1024	A	G	2: 85,904,103	V317A	probably benign	Het
Olfr1191-ps1	A	G	2: 88,643,408	I214V	probably benign	Het
Olfr1258	G	T	2: 89,930,720	D304Y	probably benign	Het
Olfr2	T	C	7: 107,001,327	T178A	probably benign	Het
Olfr791	T	A	10: 129,526,560	F111Y	possibly damaging	Het
Oprd1	T	G	4: 132,113,781	I289L	possibly damaging	Het
Orc1	A	G	4: 108,588,754	N23S	probably benign	Het
Paip1	A	T	13: 119,440,820	H149L	possibly damaging	Het
Pdhx	A	T	2: 103,046,754	D103E	probably benign	Het
Pi4ka	T	C	16: 17,291,216	Y1614C		Het
Pias3	ACC	AC	3: 96,701,385		probably null	Het
Pigb	A	G	9: 73,034,488	V163A	probably benign	Het
Pla2g4d	A	G	2: 120,284,139	I37T	possibly damaging	Het
Ppfia1	A	T	7: 144,506,245	V610D	probably damaging	Het
Prss1	T	C	6: 41,462,573	V80A	probably benign	Het
Psph	G	A	5: 129,770,736	R49W	probably benign	Het
Qrich2	T	C	11: 116,456,254	Y1248C	possibly damaging	Het
Rlbp1	T	A	7: 79,380,113	Y124F	probably damaging	Het
Scn4a	T	A	11: 106,349,169	E74V	probably benign	Het
Sgsh	A	T	11: 119,346,552	L412Q	probably damaging	Het
Shank1	C	A	7: 44,353,028	D1390E	probably benign	Het
Slc12a6	A	G	2: 112,341,974	D421G	probably damaging	Het
Snx29	T	A	16: 11,420,785		probably null	Het
Spata31d1c	A	G	13: 65,036,123	Y493C	probably damaging	Het
Stmn4	G	A	14: 66,356,278	G40E	probably damaging	Het
Stox2	A	G	8: 47,203,119		probably null	Het
Strada	T	C	11: 106,187,004	S45G	unknown	Het
Taco1	G	A	11: 106,071,948	G154S	probably benign	Het
Tas2r121	T	C	6: 132,700,542	M156V	probably benign	Het
Tbc1d31	A	G	15: 57,940,740	S384G	probably benign	Het
Tbc1d9	A	T	8: 83,239,931	D387V	probably damaging	Het
Tet3	A	G	6: 83,368,307	L1716P	probably damaging	Het
Thbs1	A	G	2: 118,113,362	K154E	possibly damaging	Het
Ush2a	T	C	1: 188,267,044	Y184H	possibly damaging	Het
Vmn1r235	C	A	17: 21,261,451	Q13K	probably benign	Het
Vmn2r15	A	T	5: 109,292,908	Y361*	probably null	Het
Vmn2r88	A	T	14: 51,410,858		probably null	Het
Vps54	T	C	11: 21,298,831	V460A	probably benign	Het
Wdr64	A	G	1: 175,785,581	N674S	possibly damaging	Het
Zfp592	A	G	7: 81,023,642	D118G	probably benign	Het
Zfp763	A	G	17: 33,018,651	Y507H	probably benign	Het
Zfp934	T	C	13: 62,492,891	E16G	probably damaging	Het
Zfyve26	G	A	12: 79,290,957	L94F	probably damaging	Het

Other mutations in Sdk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00972:Sdk2	APN	11	113854384	missense	possibly damaging	0.86
IGL01063:Sdk2	APN	11	113830842	missense	probably damaging	1.00
IGL01291:Sdk2	APN	11	113843080	missense	probably benign
IGL01316:Sdk2	APN	11	113867965	missense	probably benign	0.09
IGL01614:Sdk2	APN	11	113793858	missense	probably damaging	1.00
IGL01998:Sdk2	APN	11	113838532	missense	probably damaging	0.98
IGL02014:Sdk2	APN	11	113838494	missense	probably damaging	1.00
IGL02095:Sdk2	APN	11	113834830	missense	probably damaging	1.00
IGL02115:Sdk2	APN	11	113834813	splice site	probably benign
IGL02543:Sdk2	APN	11	113868921	missense	possibly damaging	0.90
IGL02976:Sdk2	APN	11	113851842	missense	probably damaging	1.00
IGL03001:Sdk2	APN	11	113821626	missense	probably benign	0.00
IGL03122:Sdk2	APN	11	113842068	missense	probably damaging	1.00
IGL03183:Sdk2	APN	11	113850984	missense	probably benign	0.19
IGL03222:Sdk2	APN	11	113838431	missense	probably benign	0.01
IGL03310:Sdk2	APN	11	113793325	missense	possibly damaging	0.77
Curtailed	UTSW	11	113851800	missense	probably damaging	1.00
Trimmed	UTSW	11	113856696	nonsense	probably null
ANU05:Sdk2	UTSW	11	113843080	missense	probably benign
BB008:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
BB018:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0008:Sdk2	UTSW	11	113856755	missense	probably damaging	1.00
R0088:Sdk2	UTSW	11	113827086	missense	possibly damaging	0.74
R0096:Sdk2	UTSW	11	113903144	splice site	probably benign
R0386:Sdk2	UTSW	11	113893464	missense	probably damaging	0.96
R0396:Sdk2	UTSW	11	113829967	missense	probably benign	0.04
R0409:Sdk2	UTSW	11	113850891	splice site	probably benign
R0416:Sdk2	UTSW	11	113803203	missense	probably damaging	1.00
R0456:Sdk2	UTSW	11	113791466	missense	possibly damaging	0.93
R0544:Sdk2	UTSW	11	113781010	missense	probably damaging	1.00
R0691:Sdk2	UTSW	11	113794920	splice site	probably null
R0711:Sdk2	UTSW	11	113903144	splice site	probably benign
R0717:Sdk2	UTSW	11	113832326	missense	probably damaging	1.00
R0780:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R0831:Sdk2	UTSW	11	113832258	missense	probably damaging	0.96
R0853:Sdk2	UTSW	11	113821415	missense	probably benign	0.00
R0865:Sdk2	UTSW	11	113850922	missense	probably benign	0.12
R0930:Sdk2	UTSW	11	113838445	missense	probably benign	0.01
R0964:Sdk2	UTSW	11	113806417	splice site	probably benign
R1051:Sdk2	UTSW	11	113838646	synonymous	silent
R1052:Sdk2	UTSW	11	113838646	synonymous	silent
R1054:Sdk2	UTSW	11	113838646	synonymous	silent
R1055:Sdk2	UTSW	11	113838646	synonymous	silent
R1077:Sdk2	UTSW	11	113838646	synonymous	silent
R1079:Sdk2	UTSW	11	113838646	synonymous	silent
R1115:Sdk2	UTSW	11	113838646	synonymous	silent
R1186:Sdk2	UTSW	11	113838646	synonymous	silent
R1187:Sdk2	UTSW	11	113838646	synonymous	silent
R1337:Sdk2	UTSW	11	113832331	missense	possibly damaging	0.79
R1430:Sdk2	UTSW	11	113838646	synonymous	silent
R1433:Sdk2	UTSW	11	113795045	missense	probably damaging	0.99
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1464:Sdk2	UTSW	11	113830080	missense	possibly damaging	0.86
R1497:Sdk2	UTSW	11	113893575	splice site	probably benign
R1514:Sdk2	UTSW	11	113838646	synonymous	silent
R1529:Sdk2	UTSW	11	113838646	synonymous	silent
R1596:Sdk2	UTSW	11	113838609	splice site	probably benign
R1680:Sdk2	UTSW	11	113791436	missense	possibly damaging	0.47
R1680:Sdk2	UTSW	11	113838646	synonymous	silent
R1770:Sdk2	UTSW	11	113793741	missense	probably benign	0.05
R1858:Sdk2	UTSW	11	113838646	synonymous	silent
R1866:Sdk2	UTSW	11	113838646	synonymous	silent
R1874:Sdk2	UTSW	11	113834956	missense	probably benign	0.00
R1899:Sdk2	UTSW	11	113838646	synonymous	silent
R1905:Sdk2	UTSW	11	113838646	synonymous	silent
R1907:Sdk2	UTSW	11	113838646	synonymous	silent
R1913:Sdk2	UTSW	11	113856726	missense	possibly damaging	0.77
R1964:Sdk2	UTSW	11	113781017	nonsense	probably null
R2055:Sdk2	UTSW	11	113850954	missense	probably damaging	1.00
R2059:Sdk2	UTSW	11	113854332	missense	probably damaging	1.00
R2093:Sdk2	UTSW	11	113943122	missense	probably damaging	1.00
R2256:Sdk2	UTSW	11	113830794	missense	probably benign	0.44
R3720:Sdk2	UTSW	11	113800244	missense	probably damaging	1.00
R3795:Sdk2	UTSW	11	113856696	nonsense	probably null
R4037:Sdk2	UTSW	11	113795055	missense	probably damaging	1.00
R4171:Sdk2	UTSW	11	113866989	splice site	probably null
R4717:Sdk2	UTSW	11	113854369	missense	probably damaging	0.96
R4758:Sdk2	UTSW	11	113827054	missense	possibly damaging	0.87
R4857:Sdk2	UTSW	11	113821382	nonsense	probably null
R4924:Sdk2	UTSW	11	113857758	missense	probably damaging	1.00
R5015:Sdk2	UTSW	11	113793761	missense	probably damaging	1.00
R5171:Sdk2	UTSW	11	113850982	missense	probably benign	0.01
R5239:Sdk2	UTSW	11	113868033	missense	probably damaging	1.00
R5243:Sdk2	UTSW	11	113825086	missense	possibly damaging	0.76
R5279:Sdk2	UTSW	11	113867031	missense	probably benign	0.31
R5535:Sdk2	UTSW	11	113943158	missense	possibly damaging	0.80
R5634:Sdk2	UTSW	11	113851714	missense	probably damaging	1.00
R5637:Sdk2	UTSW	11	113833179	missense	probably damaging	1.00
R5726:Sdk2	UTSW	11	113851800	missense	probably damaging	1.00
R5793:Sdk2	UTSW	11	113868952	missense	possibly damaging	0.46
R5798:Sdk2	UTSW	11	113827116	missense	probably damaging	1.00
R5834:Sdk2	UTSW	11	113854273	missense	probably damaging	1.00
R5863:Sdk2	UTSW	11	113834984	missense	probably damaging	0.98
R5869:Sdk2	UTSW	11	113851882	missense	probably damaging	0.96
R5875:Sdk2	UTSW	11	113830059	missense	probably benign	0.00
R5953:Sdk2	UTSW	11	113793744	missense	probably damaging	1.00
R5991:Sdk2	UTSW	11	113943254	missense	probably damaging	0.97
R6018:Sdk2	UTSW	11	113830063	missense	probably benign	0.00
R6116:Sdk2	UTSW	11	113854364	missense	probably damaging	0.99
R6328:Sdk2	UTSW	11	113793755	missense	probably damaging	1.00
R6348:Sdk2	UTSW	11	113893508	missense	probably benign	0.07
R6383:Sdk2	UTSW	11	113832265	missense	probably damaging	1.00
R6824:Sdk2	UTSW	11	113867934	missense	probably benign	0.43
R6835:Sdk2	UTSW	11	113830048	missense	probably damaging	0.98
R6853:Sdk2	UTSW	11	113780929	missense	probably damaging	0.99
R6912:Sdk2	UTSW	11	113903120	missense	probably benign	0.03
R7000:Sdk2	UTSW	11	113803169	missense	probably damaging	1.00
R7099:Sdk2	UTSW	11	113834905	missense	probably damaging	0.98
R7102:Sdk2	UTSW	11	113842690	nonsense	probably null
R7177:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7381:Sdk2	UTSW	11	113838489	missense	probably damaging	0.98
R7412:Sdk2	UTSW	11	113868083	splice site	probably null
R7504:Sdk2	UTSW	11	113867967	missense	possibly damaging	0.50
R7604:Sdk2	UTSW	11	113829969	missense	possibly damaging	0.91
R7647:Sdk2	UTSW	11	113793737	missense	probably damaging	1.00
R7897:Sdk2	UTSW	11	113873201	missense	possibly damaging	0.50
R7931:Sdk2	UTSW	11	113893441	missense	possibly damaging	0.79
R7998:Sdk2	UTSW	11	113859938	missense	probably benign	0.18
R8052:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8053:Sdk2	UTSW	11	113854351	missense	probably damaging	1.00
R8084:Sdk2	UTSW	11	113827089	missense	possibly damaging	0.67
R8136:Sdk2	UTSW	11	113851713	missense	probably damaging	1.00
R8151:Sdk2	UTSW	11	113872857	missense	possibly damaging	0.84
R8394:Sdk2	UTSW	11	113838716	missense	probably benign
R8715:Sdk2	UTSW	11	113780902	missense	probably damaging	1.00
R8774:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8774-TAIL:Sdk2	UTSW	11	113839343	missense	probably damaging	1.00
R8804:Sdk2	UTSW	11	113873152	nonsense	probably null
R9136:Sdk2	UTSW	11	113806377	missense	probably damaging	1.00
R9147:Sdk2	UTSW	11	113823400	missense	probably benign	0.18
R9300:Sdk2	UTSW	11	113825030	missense	possibly damaging	0.63
R9354:Sdk2	UTSW	11	113834931	missense	probably benign	0.00
R9450:Sdk2	UTSW	11	113806279	missense	probably benign
R9462:Sdk2	UTSW	11	113869918	missense	possibly damaging	0.56
R9616:Sdk2	UTSW	11	113800235	missense	probably benign	0.05
R9678:Sdk2	UTSW	11	113794963	nonsense	probably null
RF002:Sdk2	UTSW	11	113885252	missense	probably benign	0.00
V1662:Sdk2	UTSW	11	113834908	missense	probably damaging	1.00
Z1176:Sdk2	UTSW	11	113839322	missense	probably benign	0.41
Z1176:Sdk2	UTSW	11	113851836	missense	probably damaging	0.97
Z1177:Sdk2	UTSW	11	113838659	missense	probably damaging	0.99
Z1177:Sdk2	UTSW	11	113839320	missense	probably damaging	1.00
Z1177:Sdk2	UTSW	11	113859956	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGAACCCCAGAACTTGCTG -3'
(R):5'- CGTTGGGGACATTCTTCATGAC -3'

Sequencing Primer
(F):5'- AGAACTTGCTGGGACTCACC -3'
(R):5'- GGGGACATTCTTCATGACAGACATTC -3'

Posted On

2019-10-17