Incidental Mutation 'R7552:Snx29'
ID 584514
Institutional Source Beutler Lab
Gene Symbol Snx29
Ensembl Gene ENSMUSG00000071669
Gene Name sorting nexin 29
Synonyms 4933437K13Rik, LOC381035, LOC385605, Gm11170, Rundc2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7552 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 11322908-11755472 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 11420785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096273] [ENSMUST00000096273] [ENSMUST00000096273] [ENSMUST00000122168] [ENSMUST00000122168] [ENSMUST00000122168] [ENSMUST00000150993] [ENSMUST00000150993] [ENSMUST00000150993] [ENSMUST00000180792] [ENSMUST00000180792] [ENSMUST00000180792]
AlphaFold Q9D3S3
Predicted Effect probably null
Transcript: ENSMUST00000096273
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096273
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000096273
SMART Domains Protein: ENSMUSP00000093993
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 103 120 N/A INTRINSIC
coiled coil region 125 206 N/A INTRINSIC
PX 319 422 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122168
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122168
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000122168
SMART Domains Protein: ENSMUSP00000113595
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 88 105 N/A INTRINSIC
coiled coil region 110 191 N/A INTRINSIC
Blast:PX 301 326 1e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000150993
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000150993
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000150993
SMART Domains Protein: ENSMUSP00000117896
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
coiled coil region 23 104 N/A INTRINSIC
Blast:PX 217 245 3e-8 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000180792
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180792
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000180792
SMART Domains Protein: ENSMUSP00000138025
Gene: ENSMUSG00000071669

DomainStartEndE-ValueType
low complexity region 64 74 N/A INTRINSIC
RUN 115 178 7.89e-26 SMART
internal_repeat_1 192 211 2.63e-5 PROSPERO
internal_repeat_1 203 222 2.63e-5 PROSPERO
low complexity region 252 262 N/A INTRINSIC
low complexity region 270 275 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
low complexity region 445 462 N/A INTRINSIC
coiled coil region 467 548 N/A INTRINSIC
PX 661 764 3.13e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
D630045J12Rik A G 6: 38,148,448 S1544P probably damaging Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Nlrp9b T C 7: 20,045,766 S785P probably benign Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Olfr791 T A 10: 129,526,560 F111Y possibly damaging Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vmn2r88 A T 14: 51,410,858 probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp763 A G 17: 33,018,651 Y507H probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in Snx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Snx29 APN 16 11403502 missense probably damaging 0.97
IGL02207:Snx29 APN 16 11738352 missense probably damaging 1.00
PIT1430001:Snx29 UTSW 16 11403624 missense probably benign 0.00
PIT4810001:Snx29 UTSW 16 11400981 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0240:Snx29 UTSW 16 11660553 missense probably damaging 1.00
R0276:Snx29 UTSW 16 11738373 missense probably benign 0.01
R0506:Snx29 UTSW 16 11395303 missense probably benign 0.15
R0621:Snx29 UTSW 16 11405787 splice site probably null
R0975:Snx29 UTSW 16 11347871 missense possibly damaging 0.66
R1225:Snx29 UTSW 16 11420686 intron probably benign
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1406:Snx29 UTSW 16 11399793 missense probably benign 0.38
R1452:Snx29 UTSW 16 11631471 missense probably damaging 1.00
R1515:Snx29 UTSW 16 11399837 critical splice donor site probably null
R1874:Snx29 UTSW 16 11367681 missense probably benign 0.01
R1953:Snx29 UTSW 16 11399783 nonsense probably null
R1978:Snx29 UTSW 16 11367724 missense probably benign 0.23
R2054:Snx29 UTSW 16 11631492 missense probably damaging 1.00
R2105:Snx29 UTSW 16 11511034 missense possibly damaging 0.72
R2128:Snx29 UTSW 16 11400971 missense probably damaging 0.98
R2152:Snx29 UTSW 16 11400843 missense possibly damaging 0.95
R2912:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2913:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R2914:Snx29 UTSW 16 11447453 missense probably damaging 0.99
R4468:Snx29 UTSW 16 11420701 splice site probably null
R4469:Snx29 UTSW 16 11420701 splice site probably null
R4612:Snx29 UTSW 16 11447495 missense probably damaging 0.99
R4744:Snx29 UTSW 16 11349909 nonsense probably null
R4798:Snx29 UTSW 16 11420736 missense probably damaging 1.00
R5000:Snx29 UTSW 16 11403507 missense probably damaging 0.99
R5165:Snx29 UTSW 16 11420775 missense probably damaging 0.98
R5207:Snx29 UTSW 16 11738363 missense probably damaging 1.00
R5235:Snx29 UTSW 16 11413246 missense possibly damaging 0.94
R5274:Snx29 UTSW 16 11738404 missense probably damaging 1.00
R5277:Snx29 UTSW 16 11399824 missense possibly damaging 0.82
R5462:Snx29 UTSW 16 11511012 missense possibly damaging 0.89
R5655:Snx29 UTSW 16 11755321 missense probably damaging 1.00
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6036:Snx29 UTSW 16 11738437 splice site probably null
R6326:Snx29 UTSW 16 11403566 missense probably benign
R6576:Snx29 UTSW 16 11715056 critical splice donor site probably null
R7406:Snx29 UTSW 16 11755316 missense probably damaging 1.00
R7555:Snx29 UTSW 16 11400942 missense probably benign 0.02
R7736:Snx29 UTSW 16 11367724 missense probably benign 0.23
R7962:Snx29 UTSW 16 11413357 critical splice donor site probably null
R8101:Snx29 UTSW 16 11571716 missense probably benign 0.16
R8415:Snx29 UTSW 16 11447427 missense probably damaging 1.00
R8549:Snx29 UTSW 16 11715056 critical splice donor site probably null
R9010:Snx29 UTSW 16 11631527 missense probably benign 0.00
R9091:Snx29 UTSW 16 11395291 missense probably benign 0.33
R9099:Snx29 UTSW 16 11660571 missense probably damaging 1.00
R9176:Snx29 UTSW 16 11418864 missense probably benign
R9258:Snx29 UTSW 16 11714935 missense possibly damaging 0.78
R9270:Snx29 UTSW 16 11395291 missense probably benign 0.33
R9672:Snx29 UTSW 16 11660651 missense probably benign 0.00
R9778:Snx29 UTSW 16 11405745 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCCTGGGGAAACGTTTTGC -3'
(R):5'- CAGAAGGTAGCTTAGAAACCGC -3'

Sequencing Primer
(F):5'- GGAAACGTTTTGCCTGAGAG -3'
(R):5'- GCACAGAAGGTTCCTTGCATC -3'
Posted On 2019-10-17