Incidental Mutation 'R7552:Zfp763'
ID584519
Institutional Source Beutler Lab
Gene Symbol Zfp763
Ensembl Gene ENSMUSG00000067430
Gene Namezinc finger protein 763
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7552 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location33016863-33033402 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33018651 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 507 (Y507H)
Ref Sequence ENSEMBL: ENSMUSP00000084936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087654]
Predicted Effect probably benign
Transcript: ENSMUST00000087654
AA Change: Y507H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084936
Gene: ENSMUSG00000067430
AA Change: Y507H

DomainStartEndE-ValueType
KRAB 10 60 7.47e-14 SMART
ZnF_C2H2 223 245 2.53e-2 SMART
ZnF_C2H2 251 273 4.54e-4 SMART
ZnF_C2H2 279 301 1.69e-3 SMART
ZnF_C2H2 307 329 5.72e-1 SMART
ZnF_C2H2 335 357 1.64e-1 SMART
ZnF_C2H2 363 385 1.56e-2 SMART
ZnF_C2H2 391 413 1.82e-3 SMART
ZnF_C2H2 419 441 1.64e-1 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
ZnF_C2H2 475 497 2.02e-1 SMART
ZnF_C2H2 503 525 7.15e-2 SMART
ZnF_C2H2 531 553 1.79e-2 SMART
ZnF_C2H2 559 581 5.14e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (89/89)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a A G 10: 80,583,903 Y290H probably benign Het
Aco2 T C 15: 81,903,941 V257A probably damaging Het
Adam26a C A 8: 43,569,970 C161F possibly damaging Het
Adam9 G A 8: 24,955,972 P820S unknown Het
Adcy4 G A 14: 55,773,465 T665M probably benign Het
AF529169 T A 9: 89,601,835 H503L probably benign Het
Ahnak T A 19: 9,006,824 M1824K probably benign Het
Alpi T C 1: 87,099,073 N428D probably benign Het
Ano5 C T 7: 51,546,780 P153L probably benign Het
Atp1a1 A T 3: 101,582,121 L725* probably null Het
Atp8b2 G A 3: 89,946,764 T595I probably damaging Het
Ccdc66 T C 14: 27,498,863 I35V possibly damaging Het
Cd163 A G 6: 124,307,228 T120A probably benign Het
Cmah A T 13: 24,456,955 T396S possibly damaging Het
Cmya5 C T 13: 93,069,312 V3350I probably benign Het
Commd9 A C 2: 101,901,065 K198N probably damaging Het
Cxcr1 A G 1: 74,192,614 V83A probably benign Het
D630045J12Rik A G 6: 38,148,448 S1544P probably damaging Het
Ddt A T 10: 75,773,214 probably null Het
Depdc7 A G 2: 104,727,240 S222P possibly damaging Het
Ehd2 A G 7: 15,950,506 I456T probably damaging Het
Epas1 A T 17: 86,829,043 M748L probably benign Het
Esr1 G A 10: 4,856,903 R273H probably damaging Het
Fras1 G A 5: 96,768,438 D3444N probably damaging Het
Gm7682 G A 5: 94,448,535 C477Y probably damaging Het
Hand2 A G 8: 57,322,237 R111G probably damaging Het
Hecw1 A T 13: 14,316,250 V306E probably damaging Het
Ift140 T C 17: 25,033,115 I312T probably benign Het
Ikbke A T 1: 131,272,150 L257* probably null Het
Kcnk5 G A 14: 20,142,281 P271S probably benign Het
Lama1 T C 17: 67,737,667 V187A Het
Lemd2 A T 17: 27,193,836 probably null Het
Lig3 T A 11: 82,788,891 D341E probably benign Het
Lpcat1 C T 13: 73,494,895 S196L probably damaging Het
Lrp1b A T 2: 40,677,570 D4048E Het
Lrrfip1 G A 1: 91,105,283 E158K probably damaging Het
Mcm5 T C 8: 75,121,592 S490P probably damaging Het
Mia3 A C 1: 183,365,695 Y73* probably null Het
Msr1 A T 8: 39,623,962 N202K probably benign Het
N4bp2l2 A T 5: 150,661,821 Y231* probably null Het
Nbeal2 A G 9: 110,653,917 W11R probably benign Het
Ncor1 T C 11: 62,373,424 E384G possibly damaging Het
Neb A G 2: 52,247,190 V254A Het
Nlrp9b T C 7: 20,045,766 S785P probably benign Het
Olfr1024 A G 2: 85,904,103 V317A probably benign Het
Olfr1191-ps1 A G 2: 88,643,408 I214V probably benign Het
Olfr1258 G T 2: 89,930,720 D304Y probably benign Het
Olfr2 T C 7: 107,001,327 T178A probably benign Het
Olfr791 T A 10: 129,526,560 F111Y possibly damaging Het
Oprd1 T G 4: 132,113,781 I289L possibly damaging Het
Orc1 A G 4: 108,588,754 N23S probably benign Het
Paip1 A T 13: 119,440,820 H149L possibly damaging Het
Pdhx A T 2: 103,046,754 D103E probably benign Het
Pi4ka T C 16: 17,291,216 Y1614C Het
Pias3 ACC AC 3: 96,701,385 probably null Het
Pigb A G 9: 73,034,488 V163A probably benign Het
Pla2g4d A G 2: 120,284,139 I37T possibly damaging Het
Ppfia1 A T 7: 144,506,245 V610D probably damaging Het
Prss1 T C 6: 41,462,573 V80A probably benign Het
Psph G A 5: 129,770,736 R49W probably benign Het
Qrich2 T C 11: 116,456,254 Y1248C possibly damaging Het
Rlbp1 T A 7: 79,380,113 Y124F probably damaging Het
Scn4a T A 11: 106,349,169 E74V probably benign Het
Sdk2 A T 11: 113,873,213 I249N possibly damaging Het
Sgsh A T 11: 119,346,552 L412Q probably damaging Het
Shank1 C A 7: 44,353,028 D1390E probably benign Het
Slc12a6 A G 2: 112,341,974 D421G probably damaging Het
Snx29 T A 16: 11,420,785 probably null Het
Spata31d1c A G 13: 65,036,123 Y493C probably damaging Het
Stmn4 G A 14: 66,356,278 G40E probably damaging Het
Stox2 A G 8: 47,203,119 probably null Het
Strada T C 11: 106,187,004 S45G unknown Het
Taco1 G A 11: 106,071,948 G154S probably benign Het
Tas2r121 T C 6: 132,700,542 M156V probably benign Het
Tbc1d31 A G 15: 57,940,740 S384G probably benign Het
Tbc1d9 A T 8: 83,239,931 D387V probably damaging Het
Tet3 A G 6: 83,368,307 L1716P probably damaging Het
Thbs1 A G 2: 118,113,362 K154E possibly damaging Het
Ush2a T C 1: 188,267,044 Y184H possibly damaging Het
Vmn1r235 C A 17: 21,261,451 Q13K probably benign Het
Vmn2r15 A T 5: 109,292,908 Y361* probably null Het
Vmn2r88 A T 14: 51,410,858 probably null Het
Vps54 T C 11: 21,298,831 V460A probably benign Het
Wdr64 A G 1: 175,785,581 N674S possibly damaging Het
Zfp592 A G 7: 81,023,642 D118G probably benign Het
Zfp934 T C 13: 62,492,891 E16G probably damaging Het
Zfyve26 G A 12: 79,290,957 L94F probably damaging Het
Other mutations in Zfp763
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02638:Zfp763 APN 17 33019934 missense probably benign 0.41
IGL03291:Zfp763 APN 17 33019886 missense probably damaging 0.96
R0346:Zfp763 UTSW 17 33019747 missense probably benign 0.26
R0675:Zfp763 UTSW 17 33019800 missense possibly damaging 0.92
R0683:Zfp763 UTSW 17 33018918 missense probably damaging 1.00
R1494:Zfp763 UTSW 17 33021503 missense probably damaging 0.99
R1521:Zfp763 UTSW 17 33033302 start codon destroyed probably benign 0.03
R1607:Zfp763 UTSW 17 33019907 missense probably benign 0.08
R1627:Zfp763 UTSW 17 33021784 missense probably damaging 1.00
R1714:Zfp763 UTSW 17 33019617 missense probably damaging 0.99
R1993:Zfp763 UTSW 17 33018439 missense probably damaging 1.00
R2109:Zfp763 UTSW 17 33019778 missense probably benign
R4420:Zfp763 UTSW 17 33018481 missense probably benign 0.43
R4612:Zfp763 UTSW 17 33018948 missense probably benign 0.05
R5114:Zfp763 UTSW 17 33018975 missense probably damaging 0.99
R5426:Zfp763 UTSW 17 33019595 missense probably benign
R5503:Zfp763 UTSW 17 33019533 missense possibly damaging 0.95
R5534:Zfp763 UTSW 17 33021794 missense probably damaging 0.97
R6133:Zfp763 UTSW 17 33018701 missense possibly damaging 0.75
R7141:Zfp763 UTSW 17 33018795 missense probably damaging 0.97
R7365:Zfp763 UTSW 17 33033378 start gained probably benign
R7430:Zfp763 UTSW 17 33019532 missense possibly damaging 0.68
R8277:Zfp763 UTSW 17 33033320 start gained probably benign
R8446:Zfp763 UTSW 17 33019499 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCTGTAAAGTTCTCAGCTCTTC -3'
(R):5'- AGTGTGGCAAGGCATTCATTC -3'

Sequencing Primer
(F):5'- TCATGCTTCACAAGGTAGCTAC -3'
(R):5'- GGCAAGGCATTCATTCATTCCAG -3'
Posted On2019-10-17