Incidental Mutation 'R7553:L3mbtl1'
ID584528
Institutional Source Beutler Lab
Gene Symbol L3mbtl1
Ensembl Gene ENSMUSG00000035576
Gene NameL3MBTL1 histone methyl-lysine binding protein
SynonymsL3MBTL1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location162943472-162974522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162948231 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 15 (E15G)
Ref Sequence ENSEMBL: ENSMUSP00000116118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035751] [ENSMUST00000124264] [ENSMUST00000156954]
Predicted Effect probably benign
Transcript: ENSMUST00000035751
AA Change: E142G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044038
Gene: ENSMUSG00000035576
AA Change: E142G

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
MBT 280 380 5.34e-53 SMART
MBT 388 487 2.17e-53 SMART
MBT 496 591 1.49e-51 SMART
Pfam:zf-C2HC 627 655 1.7e-17 PFAM
SAM 754 821 3.49e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124264
AA Change: E15G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116118
Gene: ENSMUSG00000035576
AA Change: E15G

DomainStartEndE-ValueType
low complexity region 107 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156954
AA Change: E142G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123217
Gene: ENSMUSG00000035576
AA Change: E142G

DomainStartEndE-ValueType
low complexity region 234 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal nervous system phenotype, hematopoietic system phenotype, immune system phenotype, cellular phenotype, and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in L3mbtl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:L3mbtl1 APN 2 162967063 missense probably damaging 1.00
IGL01090:L3mbtl1 APN 2 162966005 missense probably damaging 1.00
IGL01291:L3mbtl1 APN 2 162970180 missense probably benign 0.30
IGL02897:L3mbtl1 APN 2 162965772 missense probably damaging 1.00
IGL02974:L3mbtl1 APN 2 162970183 missense possibly damaging 0.68
IGL02986:L3mbtl1 APN 2 162970305 missense probably damaging 1.00
IGL03057:L3mbtl1 APN 2 162967383 missense probably damaging 1.00
IGL03372:L3mbtl1 APN 2 162971157 splice site probably benign
ANU05:L3mbtl1 UTSW 2 162970180 missense probably benign 0.30
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0006:L3mbtl1 UTSW 2 162964569 missense possibly damaging 0.94
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0067:L3mbtl1 UTSW 2 162948828 missense probably damaging 1.00
R0078:L3mbtl1 UTSW 2 162947226 missense probably benign 0.12
R0505:L3mbtl1 UTSW 2 162947335 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971163 splice site probably benign
R0748:L3mbtl1 UTSW 2 162971164 critical splice acceptor site probably null
R0761:L3mbtl1 UTSW 2 162966047 missense probably damaging 1.00
R1789:L3mbtl1 UTSW 2 162974502 missense probably benign
R1970:L3mbtl1 UTSW 2 162959572 missense probably damaging 1.00
R2114:L3mbtl1 UTSW 2 162960070 splice site probably null
R2115:L3mbtl1 UTSW 2 162960070 splice site probably null
R2116:L3mbtl1 UTSW 2 162960070 splice site probably null
R2117:L3mbtl1 UTSW 2 162960070 splice site probably null
R2513:L3mbtl1 UTSW 2 162967585 missense probably benign
R3848:L3mbtl1 UTSW 2 162948201 missense probably damaging 1.00
R4877:L3mbtl1 UTSW 2 162948568 missense probably damaging 0.98
R4930:L3mbtl1 UTSW 2 162965772 missense probably damaging 1.00
R5930:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R5932:L3mbtl1 UTSW 2 162967336 small deletion probably benign
R6562:L3mbtl1 UTSW 2 162970204 missense probably benign 0.28
R6601:L3mbtl1 UTSW 2 162948175 start gained probably benign
R6995:L3mbtl1 UTSW 2 162961448 missense probably damaging 1.00
R7188:L3mbtl1 UTSW 2 162949540 critical splice donor site probably null
R7346:L3mbtl1 UTSW 2 162967006 missense probably benign 0.01
R7379:L3mbtl1 UTSW 2 162960979 missense probably damaging 1.00
R7474:L3mbtl1 UTSW 2 162966604 missense probably damaging 1.00
R7599:L3mbtl1 UTSW 2 162964514 missense possibly damaging 0.70
R8745:L3mbtl1 UTSW 2 162970217 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATGAGACTGGGACTGGACC -3'
(R):5'- TTCCTACTGGACAGCATCATC -3'

Sequencing Primer
(F):5'- AGGCCTCCTAGAGTACTAGCTG -3'
(R):5'- TGGACAGCATCATCCAGCCTTC -3'
Posted On2019-10-17