Incidental Mutation 'R7553:Setdb1'
ID584531
Institutional Source Beutler Lab
Gene Symbol Setdb1
Ensembl Gene ENSMUSG00000015697
Gene NameSET domain, bifurcated 1
SynonymsKMT1E, ESET
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95323525-95357202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95346765 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 242 (L242P)
Ref Sequence ENSEMBL: ENSMUSP00000015841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000107170] [ENSMUST00000107171]
Predicted Effect probably damaging
Transcript: ENSMUST00000015841
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697
AA Change: L242P

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107170
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697
AA Change: L242P

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 496 516 N/A INTRINSIC
low complexity region 529 568 N/A INTRINSIC
MBD 615 690 4.63e-33 SMART
PreSET 697 804 1.75e-41 SMART
SET 821 1289 1.76e-41 SMART
PostSET 1292 1308 1.88e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107171
AA Change: L242P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697
AA Change: L242P

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
low complexity region 121 131 N/A INTRINSIC
TUDOR 256 318 6.16e-8 SMART
TUDOR 346 401 1.03e-9 SMART
low complexity region 451 471 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 528 567 N/A INTRINSIC
MBD 614 689 4.63e-33 SMART
PreSET 696 803 1.75e-41 SMART
SET 820 1288 1.76e-41 SMART
PostSET 1291 1307 1.88e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Setdb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Setdb1 APN 3 95338577 missense probably damaging 1.00
IGL00915:Setdb1 APN 3 95346788 missense probably damaging 1.00
IGL01339:Setdb1 APN 3 95338580 nonsense probably null
IGL01710:Setdb1 APN 3 95338853 missense probably damaging 1.00
IGL02795:Setdb1 APN 3 95327373 missense probably damaging 1.00
IGL02824:Setdb1 APN 3 95339904 splice site probably benign
IGL02838:Setdb1 APN 3 95337268 splice site probably null
IGL03014:Setdb1 UTSW 3 95341415 missense probably damaging 1.00
R0077:Setdb1 UTSW 3 95341451 missense probably damaging 1.00
R0344:Setdb1 UTSW 3 95326131 unclassified probably benign
R0367:Setdb1 UTSW 3 95349881 splice site probably benign
R0374:Setdb1 UTSW 3 95324853 unclassified probably benign
R0411:Setdb1 UTSW 3 95327686 missense probably damaging 1.00
R0501:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0521:Setdb1 UTSW 3 95338829 missense probably benign 0.00
R0616:Setdb1 UTSW 3 95341798 missense probably damaging 1.00
R0828:Setdb1 UTSW 3 95338860 missense probably damaging 1.00
R0990:Setdb1 UTSW 3 95340265 missense probably benign 0.00
R1263:Setdb1 UTSW 3 95327611 missense probably damaging 0.99
R1297:Setdb1 UTSW 3 95349876 splice site probably benign
R1497:Setdb1 UTSW 3 95327467 missense probably benign 0.44
R2885:Setdb1 UTSW 3 95340195 missense probably benign
R2907:Setdb1 UTSW 3 95327201 splice site probably benign
R3236:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3237:Setdb1 UTSW 3 95338754 missense probably damaging 0.99
R3972:Setdb1 UTSW 3 95341338 missense probably damaging 1.00
R4260:Setdb1 UTSW 3 95327497 missense probably damaging 0.96
R5284:Setdb1 UTSW 3 95327570 missense probably damaging 1.00
R5484:Setdb1 UTSW 3 95337258 missense probably damaging 1.00
R5955:Setdb1 UTSW 3 95338842 missense probably damaging 1.00
R6542:Setdb1 UTSW 3 95340307 missense probably damaging 1.00
R6610:Setdb1 UTSW 3 95328577 missense probably damaging 1.00
R6632:Setdb1 UTSW 3 95324149 missense probably damaging 1.00
R6785:Setdb1 UTSW 3 95326401 missense probably benign 0.09
R7176:Setdb1 UTSW 3 95337147 critical splice donor site probably null
R7250:Setdb1 UTSW 3 95354541 critical splice donor site probably null
R7259:Setdb1 UTSW 3 95339913 missense probably benign 0.08
R7282:Setdb1 UTSW 3 95338674 missense probably damaging 1.00
R7497:Setdb1 UTSW 3 95341828 missense probably damaging 1.00
R7921:Setdb1 UTSW 3 95326399 missense possibly damaging 0.85
R8022:Setdb1 UTSW 3 95338599 missense probably damaging 1.00
R8022:Setdb1 UTSW 3 95347085 missense probably damaging 1.00
R8189:Setdb1 UTSW 3 95346711 missense probably damaging 1.00
R8558:Setdb1 UTSW 3 95354668 missense possibly damaging 0.88
R8693:Setdb1 UTSW 3 95341730 missense probably damaging 0.99
R8812:Setdb1 UTSW 3 95356060 missense probably damaging 1.00
Z1177:Setdb1 UTSW 3 95338530 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGAATAGATGGCACCAGGC -3'
(R):5'- GGTAACCTGTAGGGCATCCATTG -3'

Sequencing Primer
(F):5'- AGGCCCCATTCTCCTACAATC -3'
(R):5'- ATTGCTGACTGTTTTTCCAAAGC -3'
Posted On2019-10-17