Incidental Mutation 'R7553:Slc9a1'
ID584537
Institutional Source Beutler Lab
Gene Symbol Slc9a1
Ensembl Gene ENSMUSG00000028854
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 1
SynonymsApnh, Nhe1, antiporter
MMRRC Submission
Accession Numbers

Genbank: NM_016981; MGI: 102462

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location133369706-133423702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133412269 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 266 (E266G)
Ref Sequence ENSEMBL: ENSMUSP00000030669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030669]
Predicted Effect probably damaging
Transcript: ENSMUST00000030669
AA Change: E266G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854
AA Change: E266G

DomainStartEndE-ValueType
transmembrane domain 15 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 109 509 1.3e-89 PFAM
Pfam:NEXCaM_BD 603 704 1.5e-34 PFAM
low complexity region 757 764 N/A INTRINSIC
low complexity region 803 814 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Slc9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc9a1 APN 4 133370548 missense probably benign 0.03
IGL00949:Slc9a1 APN 4 133416451 missense probably benign 0.03
IGL00952:Slc9a1 APN 4 133416382 missense probably damaging 0.99
IGL01023:Slc9a1 APN 4 133422143 missense probably benign 0.04
IGL01151:Slc9a1 APN 4 133411989 missense probably damaging 1.00
IGL01796:Slc9a1 APN 4 133420093 splice site probably benign
IGL01896:Slc9a1 APN 4 133418059 missense probably damaging 1.00
IGL02621:Slc9a1 APN 4 133370568 missense probably benign
F6893:Slc9a1 UTSW 4 133422146 missense probably benign 0.06
R0123:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0134:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0225:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0658:Slc9a1 UTSW 4 133420499 splice site probably benign
R0759:Slc9a1 UTSW 4 133416403 missense probably damaging 1.00
R0781:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1110:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1316:Slc9a1 UTSW 4 133422247 missense possibly damaging 0.95
R1637:Slc9a1 UTSW 4 133422223 missense probably benign
R1680:Slc9a1 UTSW 4 133418080 missense probably damaging 1.00
R2050:Slc9a1 UTSW 4 133416334 missense probably benign 0.02
R4279:Slc9a1 UTSW 4 133412089 missense probably benign 0.31
R4960:Slc9a1 UTSW 4 133370656 missense probably damaging 1.00
R5381:Slc9a1 UTSW 4 133422071 missense probably damaging 0.96
R5590:Slc9a1 UTSW 4 133421563 missense probably damaging 0.99
R5638:Slc9a1 UTSW 4 133412260 missense probably damaging 1.00
R5935:Slc9a1 UTSW 4 133419865 intron probably benign
R6334:Slc9a1 UTSW 4 133422208 missense possibly damaging 0.64
R6402:Slc9a1 UTSW 4 133370651 missense probably benign 0.37
R7772:Slc9a1 UTSW 4 133411965 missense probably damaging 1.00
R7843:Slc9a1 UTSW 4 133370442 start gained probably benign
R8268:Slc9a1 UTSW 4 133370623 missense probably benign 0.08
R8359:Slc9a1 UTSW 4 133420616 missense probably damaging 1.00
R8398:Slc9a1 UTSW 4 133419503 missense probably benign 0.05
X0018:Slc9a1 UTSW 4 133418071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTGGAATGCGTTCTTCC -3'
(R):5'- GCCGCACTCTAGTAAGCTAAC -3'

Sequencing Primer
(F):5'- CGTTCTTCCTGGGTGGCC -3'
(R):5'- GGTAAGAAAATACGTCTCTCCTCGG -3'
Posted On2019-10-17