Incidental Mutation 'R7553:Acad10'
ID 584539
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Name acyl-Coenzyme A dehydrogenase family, member 10
Synonyms 2410021P16Rik
MMRRC Submission 045622-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7553 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 121759089-121798577 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121777318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 371 (Y371C)
Ref Sequence ENSEMBL: ENSMUSP00000031412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
AlphaFold Q8K370
Predicted Effect probably damaging
Transcript: ENSMUST00000031412
AA Change: Y371C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: Y371C

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111770
AA Change: Y371C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: Y371C

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,648,545 (GRCm39) L649P probably damaging Het
Avp A G 2: 130,423,098 (GRCm39) V71A probably damaging Het
Bhmt C T 13: 93,756,589 (GRCm39) probably null Het
Capn15 T C 17: 26,179,738 (GRCm39) E874G probably damaging Het
Capn5 A G 7: 97,773,231 (GRCm39) F591S probably damaging Het
Ccne2 A T 4: 11,201,348 (GRCm39) Q292L probably benign Het
Cd96 T G 16: 45,872,384 (GRCm39) T406P probably damaging Het
Csnk1e G A 15: 79,310,566 (GRCm39) A153V probably damaging Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Dmbt1 A G 7: 130,706,597 (GRCm39) N1372S unknown Het
Dntt A T 19: 41,017,926 (GRCm39) R17W probably damaging Het
Erich3 G T 3: 154,439,137 (GRCm39) A260S probably benign Het
Foxp2 C T 6: 15,437,881 (GRCm39) S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Grid2 A G 6: 64,053,925 (GRCm39) K375E possibly damaging Het
Grin2b C T 6: 135,749,394 (GRCm39) G603S possibly damaging Het
Hexb C T 13: 97,334,681 (GRCm39) R30Q probably benign Het
Homer3 A T 8: 70,742,774 (GRCm39) T162S probably benign Het
L3mbtl1 A G 2: 162,790,151 (GRCm39) E15G probably benign Het
Manea A T 4: 26,327,986 (GRCm39) F352I probably damaging Het
Mcf2l T A 8: 13,047,268 (GRCm39) M210K probably benign Het
Morc3 T C 16: 93,667,824 (GRCm39) L734P probably damaging Het
Mybpc2 A G 7: 44,155,571 (GRCm39) V894A possibly damaging Het
Myh4 T A 11: 67,147,221 (GRCm39) M1622K probably damaging Het
Myrf A G 19: 10,206,240 (GRCm39) F59L probably benign Het
Ndst3 G T 3: 123,350,709 (GRCm39) probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nos3 A T 5: 24,586,715 (GRCm39) D986V possibly damaging Het
Nrp1 G A 8: 129,158,468 (GRCm39) A252T probably damaging Het
Nup205 G T 6: 35,178,934 (GRCm39) R668L probably damaging Het
Or51aa2 T C 7: 103,188,363 (GRCm39) Y26C probably damaging Het
Or5af2 T A 11: 58,707,886 (GRCm39) D17E probably benign Het
Or5p56 G A 7: 107,589,682 (GRCm39) V37I probably benign Het
Pcdhga1 T A 18: 37,882,735 (GRCm39) probably null Het
Pck1 A G 2: 172,998,860 (GRCm39) I373V probably benign Het
Pde8b T C 13: 95,223,258 (GRCm39) N227S probably benign Het
Pianp T G 6: 124,976,214 (GRCm39) S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2r1 A T 2: 60,353,243 (GRCm39) N239K possibly damaging Het
Pls1 T A 9: 95,669,140 (GRCm39) N27I probably damaging Het
Prep T C 10: 45,034,620 (GRCm39) *711Q probably null Het
Prkag3 A G 1: 74,783,894 (GRCm39) F330L probably damaging Het
Prss56 A G 1: 87,111,261 (GRCm39) D16G probably benign Het
Rad17 A T 13: 100,769,794 (GRCm39) F255Y probably damaging Het
Rap1gap2 T C 11: 74,326,548 (GRCm39) E173G probably damaging Het
Retreg3 C T 11: 100,997,216 (GRCm39) R88H possibly damaging Het
Rhag G A 17: 41,139,286 (GRCm39) G74R probably damaging Het
Rybp A G 6: 100,209,220 (GRCm39) S201P possibly damaging Het
S100a10 G A 3: 93,471,602 (GRCm39) C62Y probably benign Het
Scgb2b3 T A 7: 31,059,673 (GRCm39) S34C possibly damaging Het
Serpind1 A G 16: 17,154,539 (GRCm39) D122G probably benign Het
Setdb1 A G 3: 95,254,076 (GRCm39) L242P probably damaging Het
Slc14a2 T A 18: 78,198,803 (GRCm39) I776F probably damaging Het
Slc9a1 A G 4: 133,139,580 (GRCm39) E266G probably damaging Het
Stard9 A T 2: 120,524,289 (GRCm39) probably null Het
Stpg2 A G 3: 138,924,098 (GRCm39) Y167C probably damaging Het
Tex264 T C 9: 106,536,335 (GRCm39) E274G probably damaging Het
Tigd2 G A 6: 59,188,564 (GRCm39) S477N probably benign Het
Urb1 A G 16: 90,589,752 (GRCm39) L343P probably damaging Het
Vars2 A T 17: 35,975,680 (GRCm39) C246S possibly damaging Het
Vil1 G A 1: 74,465,891 (GRCm39) probably null Het
Vmn2r61 C G 7: 41,916,205 (GRCm39) L273V not run Het
Vmn2r-ps158 T G 7: 42,697,447 (GRCm39) C835G probably damaging Het
Zfp37 C A 4: 62,110,236 (GRCm39) G317V probably damaging Het
Zfp760 A G 17: 21,941,872 (GRCm39) K349R possibly damaging Het
Zyx A T 6: 42,327,408 (GRCm39) E69V probably null Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121,760,106 (GRCm39) missense probably damaging 1.00
IGL02469:Acad10 APN 5 121,783,522 (GRCm39) missense probably damaging 1.00
IGL02526:Acad10 APN 5 121,784,923 (GRCm39) missense probably damaging 0.99
IGL02623:Acad10 APN 5 121,767,993 (GRCm39) missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121,769,633 (GRCm39) missense probably benign
IGL02685:Acad10 APN 5 121,770,672 (GRCm39) missense probably benign
IGL03139:Acad10 APN 5 121,764,145 (GRCm39) missense probably benign
IGL03267:Acad10 APN 5 121,775,412 (GRCm39) missense probably benign 0.34
P0026:Acad10 UTSW 5 121,775,415 (GRCm39) missense probably damaging 1.00
R0099:Acad10 UTSW 5 121,759,353 (GRCm39) missense probably damaging 1.00
R0453:Acad10 UTSW 5 121,765,445 (GRCm39) nonsense probably null
R1051:Acad10 UTSW 5 121,764,143 (GRCm39) missense probably damaging 0.97
R1052:Acad10 UTSW 5 121,787,604 (GRCm39) missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121,768,814 (GRCm39) missense probably damaging 1.00
R1548:Acad10 UTSW 5 121,764,104 (GRCm39) splice site probably benign
R1548:Acad10 UTSW 5 121,764,103 (GRCm39) splice site probably benign
R1571:Acad10 UTSW 5 121,759,411 (GRCm39) missense probably damaging 0.99
R1592:Acad10 UTSW 5 121,783,444 (GRCm39) missense probably damaging 0.99
R1741:Acad10 UTSW 5 121,785,899 (GRCm39) missense probably damaging 1.00
R1789:Acad10 UTSW 5 121,769,456 (GRCm39) missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121,764,248 (GRCm39) missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121,772,814 (GRCm39) missense probably damaging 1.00
R2085:Acad10 UTSW 5 121,787,523 (GRCm39) missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121,767,990 (GRCm39) missense probably benign 0.23
R2511:Acad10 UTSW 5 121,769,630 (GRCm39) missense probably benign 0.02
R2570:Acad10 UTSW 5 121,768,267 (GRCm39) missense probably damaging 1.00
R3824:Acad10 UTSW 5 121,760,881 (GRCm39) missense probably benign
R3846:Acad10 UTSW 5 121,772,749 (GRCm39) missense probably benign 0.19
R4106:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R4107:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R4108:Acad10 UTSW 5 121,769,527 (GRCm39) missense probably damaging 0.98
R5569:Acad10 UTSW 5 121,764,143 (GRCm39) missense probably damaging 0.97
R5704:Acad10 UTSW 5 121,769,606 (GRCm39) missense probably benign 0.03
R5845:Acad10 UTSW 5 121,764,146 (GRCm39) missense probably benign
R5990:Acad10 UTSW 5 121,783,468 (GRCm39) missense probably damaging 1.00
R6019:Acad10 UTSW 5 121,772,864 (GRCm39) missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121,760,096 (GRCm39) missense probably damaging 0.97
R6384:Acad10 UTSW 5 121,790,066 (GRCm39) missense probably benign 0.43
R6491:Acad10 UTSW 5 121,768,220 (GRCm39) missense probably damaging 1.00
R6608:Acad10 UTSW 5 121,770,555 (GRCm39) missense probably benign 0.02
R6941:Acad10 UTSW 5 121,787,420 (GRCm39) missense probably damaging 1.00
R7221:Acad10 UTSW 5 121,768,273 (GRCm39) missense probably damaging 1.00
R7283:Acad10 UTSW 5 121,787,538 (GRCm39) missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121,768,780 (GRCm39) nonsense probably null
R7483:Acad10 UTSW 5 121,794,075 (GRCm39) critical splice donor site probably null
R7721:Acad10 UTSW 5 121,784,929 (GRCm39) splice site probably null
R8075:Acad10 UTSW 5 121,790,148 (GRCm39) missense probably benign 0.00
R8400:Acad10 UTSW 5 121,764,268 (GRCm39) missense possibly damaging 0.82
R9171:Acad10 UTSW 5 121,767,981 (GRCm39) missense probably benign 0.14
X0061:Acad10 UTSW 5 121,760,876 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAGCTTCGCTTTGTG -3'
(R):5'- CACAGAGCTGGGTGTTTAGAG -3'

Sequencing Primer
(F):5'- AGCTTCGCTTTGTGAGAGGAAC -3'
(R):5'- TTTAGAGGGGTGTTGGGAAC -3'
Posted On 2019-10-17