Incidental Mutation 'R7553:Foxp2'
ID584540
Institutional Source Beutler Lab
Gene Symbol Foxp2
Ensembl Gene ENSMUSG00000029563
Gene Nameforkhead box P2
SynonymsD0Kist7, 2810043D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location14901349-15441977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15437882 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 669 (S669L)
Ref Sequence ENSEMBL: ENSMUSP00000111137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031545] [ENSMUST00000115472] [ENSMUST00000115474] [ENSMUST00000115475] [ENSMUST00000115477]
Predicted Effect unknown
Transcript: ENSMUST00000031545
AA Change: S669L
SMART Domains Protein: ENSMUSP00000031545
Gene: ENSMUSG00000029563
AA Change: S669L

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115472
AA Change: S648L
SMART Domains Protein: ENSMUSP00000111132
Gene: ENSMUSG00000029563
AA Change: S648L

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 116 194 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
ZnF_C2H2 324 349 3.02e0 SMART
low complexity region 416 437 N/A INTRINSIC
FH 480 561 7.5e-37 SMART
low complexity region 584 603 N/A INTRINSIC
low complexity region 676 693 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115474
AA Change: S694L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111134
Gene: ENSMUSG00000029563
AA Change: S694L

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 462 483 N/A INTRINSIC
FH 526 607 7.5e-37 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 722 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115475
SMART Domains Protein: ENSMUSP00000111135
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 8 46 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115477
AA Change: S669L
SMART Domains Protein: ENSMUSP00000111137
Gene: ENSMUSG00000029563
AA Change: S669L

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Meta Mutation Damage Score 0.0643 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, growth retardation, reduced vocalization, prolonged external granule cell layer presence, abnormal Purkinje and radial glial cells, delayed eye opening and ear emergence, negative geotaxis, impaired righting response, and hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Foxp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Foxp2 APN 6 15403819 missense probably damaging 1.00
IGL01011:Foxp2 APN 6 15438019 makesense probably null
IGL01412:Foxp2 APN 6 15376758 intron probably benign
IGL01769:Foxp2 APN 6 15409835 missense possibly damaging 0.92
IGL02578:Foxp2 APN 6 15376815 intron probably benign
IGL03368:Foxp2 APN 6 15394718 missense probably damaging 1.00
R0004:Foxp2 UTSW 6 15197096 missense possibly damaging 0.68
R0081:Foxp2 UTSW 6 15405644 critical splice donor site probably benign
R0095:Foxp2 UTSW 6 15196977 missense probably damaging 1.00
R0233:Foxp2 UTSW 6 15409753 missense probably damaging 1.00
R0294:Foxp2 UTSW 6 15376774 intron probably benign
R0357:Foxp2 UTSW 6 15409840 missense probably damaging 0.99
R0432:Foxp2 UTSW 6 15254279 intron probably benign
R0659:Foxp2 UTSW 6 15254279 intron probably benign
R1381:Foxp2 UTSW 6 15409766 missense possibly damaging 0.50
R1813:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R1896:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R2007:Foxp2 UTSW 6 15396819 missense probably damaging 1.00
R2020:Foxp2 UTSW 6 15324644 missense possibly damaging 0.73
R2167:Foxp2 UTSW 6 15437902 missense probably damaging 1.00
R2326:Foxp2 UTSW 6 15409939 missense possibly damaging 0.84
R3829:Foxp2 UTSW 6 15379831 unclassified probably benign
R3978:Foxp2 UTSW 6 15197208 unclassified probably benign
R4393:Foxp2 UTSW 6 15377690 intron probably benign
R4703:Foxp2 UTSW 6 15411248 missense probably benign 0.03
R5202:Foxp2 UTSW 6 15394771 missense probably benign 0.05
R5303:Foxp2 UTSW 6 15324637 missense probably benign 0.00
R5368:Foxp2 UTSW 6 15377914 intron probably benign
R5533:Foxp2 UTSW 6 15197120 nonsense probably null
R5655:Foxp2 UTSW 6 15197113 missense probably damaging 0.99
R6220:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R6241:Foxp2 UTSW 6 15394762 missense probably damaging 1.00
R6365:Foxp2 UTSW 6 15286685 missense probably damaging 1.00
R6384:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R7217:Foxp2 UTSW 6 15416024 missense unknown
R7881:Foxp2 UTSW 6 15409889 missense unknown
R8420:Foxp2 UTSW 6 15403867 missense unknown
X0023:Foxp2 UTSW 6 15409835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCAGCATGTGGAGGTTC -3'
(R):5'- CAGTGATATGTCCCTTCACACTG -3'

Sequencing Primer
(F):5'- CATGTGGAGGTTCATGCACACATAC -3'
(R):5'- CACTGAGGTGTCACAAGTTCG -3'
Posted On2019-10-17