Incidental Mutation 'R7553:Tigd2'
ID584543
Institutional Source Beutler Lab
Gene Symbol Tigd2
Ensembl Gene ENSMUSG00000049232
Gene Nametigger transposable element derived 2
Synonyms3632410O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location59208870-59212033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 59211579 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 477 (S477N)
Ref Sequence ENSEMBL: ENSMUSP00000057223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062626]
Predicted Effect probably benign
Transcript: ENSMUST00000062626
AA Change: S477N

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057223
Gene: ENSMUSG00000049232
AA Change: S477N

DomainStartEndE-ValueType
Pfam:CENP-B_N 4 54 6e-17 PFAM
CENPB 73 139 5.78e-19 SMART
Pfam:DDE_1 206 385 2.2e-52 PFAM
low complexity region 504 519 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Grin2b C T 6: 135,772,396 G603S possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Tigd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02304:Tigd2 APN 6 59211698 nonsense probably null
IGL03356:Tigd2 APN 6 59211705 missense probably benign 0.04
PIT1430001:Tigd2 UTSW 6 59211248 missense probably damaging 1.00
R0048:Tigd2 UTSW 6 59211384 missense possibly damaging 0.86
R0387:Tigd2 UTSW 6 59211158 missense probably benign 0.00
R0523:Tigd2 UTSW 6 59210373 missense probably benign 0.30
R0636:Tigd2 UTSW 6 59211287 missense possibly damaging 0.66
R1171:Tigd2 UTSW 6 59211376 missense possibly damaging 0.73
R2440:Tigd2 UTSW 6 59209995 start gained probably benign
R4327:Tigd2 UTSW 6 59210577 missense probably benign 0.36
R4731:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4732:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R4733:Tigd2 UTSW 6 59211415 missense probably benign 0.00
R5005:Tigd2 UTSW 6 59211146 missense probably benign 0.06
R5028:Tigd2 UTSW 6 59211220 nonsense probably null
R5248:Tigd2 UTSW 6 59211153 missense probably damaging 1.00
R6006:Tigd2 UTSW 6 59210777 missense possibly damaging 0.45
R7099:Tigd2 UTSW 6 59210181 missense probably damaging 1.00
R7261:Tigd2 UTSW 6 59211067 missense probably benign 0.02
R7688:Tigd2 UTSW 6 59210397 missense probably damaging 1.00
R8002:Tigd2 UTSW 6 59210509 missense probably damaging 1.00
R8734:Tigd2 UTSW 6 59210199 missense probably damaging 1.00
Z1177:Tigd2 UTSW 6 59211530 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGGTTTTGCAGAATACTGAAG -3'
(R):5'- AATTCCACTGCAGATAGAAGTCAC -3'

Sequencing Primer
(F):5'- TTGCAGAATACTGAAGACTGTGAAC -3'
(R):5'- CACTGCAGATAGAAGTCACAAAGATG -3'
Posted On2019-10-17