Incidental Mutation 'R7553:Grin2b'
ID584547
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7553 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135772396 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 603 (G603S)
Ref Sequence ENSEMBL: ENSMUSP00000062284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053880
AA Change: G603S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: G603S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111905
AA Change: G603S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: G603S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.3464 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 A G 7: 45,999,121 L649P probably damaging Het
Acad10 T C 5: 121,639,255 Y371C probably damaging Het
Avp A G 2: 130,581,178 V71A probably damaging Het
Bhmt C T 13: 93,620,081 probably null Het
Capn15 T C 17: 25,960,764 E874G probably damaging Het
Capn5 A G 7: 98,124,024 F591S probably damaging Het
Ccne2 A T 4: 11,201,348 Q292L probably benign Het
Cd96 T G 16: 46,052,021 T406P probably damaging Het
Csnk1e G A 15: 79,426,366 A153V probably damaging Het
Dlk1 G A 12: 109,454,963 V15I unknown Het
Dmbt1 A G 7: 131,104,867 N1372S unknown Het
Dntt A T 19: 41,029,487 R17W probably damaging Het
Erich3 G T 3: 154,733,500 A260S probably benign Het
Foxp2 C T 6: 15,437,882 S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm9268 T G 7: 43,048,023 C835G probably damaging Het
Grid2 A G 6: 64,076,941 K375E possibly damaging Het
Hexb C T 13: 97,198,173 R30Q probably benign Het
Homer3 A T 8: 70,290,124 T162S probably benign Het
L3mbtl1 A G 2: 162,948,231 E15G probably benign Het
Manea A T 4: 26,327,986 F352I probably damaging Het
Mcf2l T A 8: 12,997,268 M210K probably benign Het
Morc3 T C 16: 93,870,936 L734P probably damaging Het
Mybpc2 A G 7: 44,506,147 V894A possibly damaging Het
Myh4 T A 11: 67,256,395 M1622K probably damaging Het
Myrf A G 19: 10,228,876 F59L probably benign Het
Ndst3 G T 3: 123,557,060 probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,050,416 probably null Het
Nos3 A T 5: 24,381,717 D986V possibly damaging Het
Nrp1 G A 8: 128,431,987 A252T probably damaging Het
Nup205 G T 6: 35,201,999 R668L probably damaging Het
Olfr313 T A 11: 58,817,060 D17E probably benign Het
Olfr477 G A 7: 107,990,475 V37I probably benign Het
Olfr612 T C 7: 103,539,156 Y26C probably damaging Het
Pcdhga1 T A 18: 37,749,682 probably null Het
Pck1 A G 2: 173,157,067 I373V probably benign Het
Pde8b T C 13: 95,086,750 N227S probably benign Het
Pianp T G 6: 124,999,251 S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pla2r1 A T 2: 60,522,899 N239K possibly damaging Het
Pls1 T A 9: 95,787,087 N27I probably damaging Het
Prep T C 10: 45,158,524 *711Q probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Prss56 A G 1: 87,183,539 D16G probably benign Het
Rad17 A T 13: 100,633,286 F255Y probably damaging Het
Rap1gap2 T C 11: 74,435,722 E173G probably damaging Het
Retreg3 C T 11: 101,106,390 R88H possibly damaging Het
Rhag G A 17: 40,828,395 G74R probably damaging Het
Rybp A G 6: 100,232,259 S201P possibly damaging Het
S100a10 G A 3: 93,564,295 C62Y probably benign Het
Scgb2b3 T A 7: 31,360,248 S34C possibly damaging Het
Serpind1 A G 16: 17,336,675 D122G probably benign Het
Setdb1 A G 3: 95,346,765 L242P probably damaging Het
Slc14a2 T A 18: 78,155,588 I776F probably damaging Het
Slc9a1 A G 4: 133,412,269 E266G probably damaging Het
Stard9 A T 2: 120,693,808 probably null Het
Stpg2 A G 3: 139,218,337 Y167C probably damaging Het
Tex264 T C 9: 106,659,136 E274G probably damaging Het
Tigd2 G A 6: 59,211,579 S477N probably benign Het
Urb1 A G 16: 90,792,864 L343P probably damaging Het
Vars2 A T 17: 35,664,788 C246S possibly damaging Het
Vil1 G A 1: 74,426,732 probably null Het
Vmn2r61 C G 7: 42,266,781 L273V not run Het
Zfp37 C A 4: 62,191,999 G317V probably damaging Het
Zfp760 A G 17: 21,722,891 K349R possibly damaging Het
Zyx A T 6: 42,350,474 E69V probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCTCTTGGATCATGAAGGC -3'
(R):5'- GGGCTCTGGAGTTACCTCTAAG -3'

Sequencing Primer
(F):5'- TCTTGGATCATGAAGGCGGCTAAG -3'
(R):5'- CACAGGATCTTGACTTGTGAAGC -3'
Posted On2019-10-17