Incidental Mutation 'R7553:Abcc6'
ID 584552
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 045622-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.822) question?
Stock # R7553 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45648545 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 649 (L649P)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: L649P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: L649P

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,777,318 (GRCm39) Y371C probably damaging Het
Avp A G 2: 130,423,098 (GRCm39) V71A probably damaging Het
Bhmt C T 13: 93,756,589 (GRCm39) probably null Het
Capn15 T C 17: 26,179,738 (GRCm39) E874G probably damaging Het
Capn5 A G 7: 97,773,231 (GRCm39) F591S probably damaging Het
Ccne2 A T 4: 11,201,348 (GRCm39) Q292L probably benign Het
Cd96 T G 16: 45,872,384 (GRCm39) T406P probably damaging Het
Csnk1e G A 15: 79,310,566 (GRCm39) A153V probably damaging Het
Dlk1 G A 12: 109,420,889 (GRCm39) V15I unknown Het
Dmbt1 A G 7: 130,706,597 (GRCm39) N1372S unknown Het
Dntt A T 19: 41,017,926 (GRCm39) R17W probably damaging Het
Erich3 G T 3: 154,439,137 (GRCm39) A260S probably benign Het
Foxp2 C T 6: 15,437,881 (GRCm39) S669L unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Grid2 A G 6: 64,053,925 (GRCm39) K375E possibly damaging Het
Grin2b C T 6: 135,749,394 (GRCm39) G603S possibly damaging Het
Hexb C T 13: 97,334,681 (GRCm39) R30Q probably benign Het
Homer3 A T 8: 70,742,774 (GRCm39) T162S probably benign Het
L3mbtl1 A G 2: 162,790,151 (GRCm39) E15G probably benign Het
Manea A T 4: 26,327,986 (GRCm39) F352I probably damaging Het
Mcf2l T A 8: 13,047,268 (GRCm39) M210K probably benign Het
Morc3 T C 16: 93,667,824 (GRCm39) L734P probably damaging Het
Mybpc2 A G 7: 44,155,571 (GRCm39) V894A possibly damaging Het
Myh4 T A 11: 67,147,221 (GRCm39) M1622K probably damaging Het
Myrf A G 19: 10,206,240 (GRCm39) F59L probably benign Het
Ndst3 G T 3: 123,350,709 (GRCm39) probably null Het
Nln TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC TGGTCCAGGTAAAACTGCCCCAGCCAATCAGGTACCTTGGATAGAGGTCCAGGTAGAACTGCCCCAGC 13: 104,186,924 (GRCm39) probably null Het
Nos3 A T 5: 24,586,715 (GRCm39) D986V possibly damaging Het
Nrp1 G A 8: 129,158,468 (GRCm39) A252T probably damaging Het
Nup205 G T 6: 35,178,934 (GRCm39) R668L probably damaging Het
Or51aa2 T C 7: 103,188,363 (GRCm39) Y26C probably damaging Het
Or5af2 T A 11: 58,707,886 (GRCm39) D17E probably benign Het
Or5p56 G A 7: 107,589,682 (GRCm39) V37I probably benign Het
Pcdhga1 T A 18: 37,882,735 (GRCm39) probably null Het
Pck1 A G 2: 172,998,860 (GRCm39) I373V probably benign Het
Pde8b T C 13: 95,223,258 (GRCm39) N227S probably benign Het
Pianp T G 6: 124,976,214 (GRCm39) S8A unknown Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pla2r1 A T 2: 60,353,243 (GRCm39) N239K possibly damaging Het
Pls1 T A 9: 95,669,140 (GRCm39) N27I probably damaging Het
Prep T C 10: 45,034,620 (GRCm39) *711Q probably null Het
Prkag3 A G 1: 74,783,894 (GRCm39) F330L probably damaging Het
Prss56 A G 1: 87,111,261 (GRCm39) D16G probably benign Het
Rad17 A T 13: 100,769,794 (GRCm39) F255Y probably damaging Het
Rap1gap2 T C 11: 74,326,548 (GRCm39) E173G probably damaging Het
Retreg3 C T 11: 100,997,216 (GRCm39) R88H possibly damaging Het
Rhag G A 17: 41,139,286 (GRCm39) G74R probably damaging Het
Rybp A G 6: 100,209,220 (GRCm39) S201P possibly damaging Het
S100a10 G A 3: 93,471,602 (GRCm39) C62Y probably benign Het
Scgb2b3 T A 7: 31,059,673 (GRCm39) S34C possibly damaging Het
Serpind1 A G 16: 17,154,539 (GRCm39) D122G probably benign Het
Setdb1 A G 3: 95,254,076 (GRCm39) L242P probably damaging Het
Slc14a2 T A 18: 78,198,803 (GRCm39) I776F probably damaging Het
Slc9a1 A G 4: 133,139,580 (GRCm39) E266G probably damaging Het
Stard9 A T 2: 120,524,289 (GRCm39) probably null Het
Stpg2 A G 3: 138,924,098 (GRCm39) Y167C probably damaging Het
Tex264 T C 9: 106,536,335 (GRCm39) E274G probably damaging Het
Tigd2 G A 6: 59,188,564 (GRCm39) S477N probably benign Het
Urb1 A G 16: 90,589,752 (GRCm39) L343P probably damaging Het
Vars2 A T 17: 35,975,680 (GRCm39) C246S possibly damaging Het
Vil1 G A 1: 74,465,891 (GRCm39) probably null Het
Vmn2r61 C G 7: 41,916,205 (GRCm39) L273V not run Het
Vmn2r-ps158 T G 7: 42,697,447 (GRCm39) C835G probably damaging Het
Zfp37 C A 4: 62,110,236 (GRCm39) G317V probably damaging Het
Zfp760 A G 17: 21,941,872 (GRCm39) K349R possibly damaging Het
Zyx A T 6: 42,327,408 (GRCm39) E69V probably null Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4013:Abcc6 UTSW 7 45,668,104 (GRCm39) missense probably benign 0.01
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACGCATGCAGCATCTC -3'
(R):5'- TATGTGGCAGGCACATCTG -3'

Sequencing Primer
(F):5'- TCTCTGAAAATACACCTTAGCGG -3'
(R):5'- TGATGTGCTCAGACGGCAG -3'
Posted On 2019-10-17